ID: 1100278513

View in Genome Browser
Species Human (GRCh38)
Location 12:93095021-93095043
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100278510_1100278513 16 Left 1100278510 12:93094982-93095004 CCAATCTTTTAAAATTCTATTAC No data
Right 1100278513 12:93095021-93095043 CAAAGGGAACACCTTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100278513 Original CRISPR CAAAGGGAACACCTTGTCCC TGG Intergenic
No off target data available for this crispr