ID: 1100290050

View in Genome Browser
Species Human (GRCh38)
Location 12:93205036-93205058
Sequence GTTTTAGGACGATTGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100290050_1100290055 8 Left 1100290050 12:93205036-93205058 CCTGCTGCCAATCGTCCTAAAAC No data
Right 1100290055 12:93205067-93205089 TCAGAAAGTTAGCCCCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100290050 Original CRISPR GTTTTAGGACGATTGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr