ID: 1100295694

View in Genome Browser
Species Human (GRCh38)
Location 12:93258825-93258847
Sequence TTGTGTATGCATGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100295694_1100295698 11 Left 1100295694 12:93258825-93258847 CCTTCCTCTTCATGCATACACAA No data
Right 1100295698 12:93258859-93258881 GTGAAGAGGAAGTGAGAGATAGG No data
1100295694_1100295696 -3 Left 1100295694 12:93258825-93258847 CCTTCCTCTTCATGCATACACAA No data
Right 1100295696 12:93258845-93258867 CAAAAGAATGCCAAGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100295694 Original CRISPR TTGTGTATGCATGAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr