ID: 1100299218

View in Genome Browser
Species Human (GRCh38)
Location 12:93291806-93291828
Sequence CACCATGAGCACATGTTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2714
Summary {0: 2, 1: 29, 2: 491, 3: 861, 4: 1331}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100299209_1100299218 18 Left 1100299209 12:93291765-93291787 CCTGTCCCCCTAAAGTGCATAAA No data
Right 1100299218 12:93291806-93291828 CACCATGAGCACATGTTCTCGGG 0: 2
1: 29
2: 491
3: 861
4: 1331
1100299213_1100299218 10 Left 1100299213 12:93291773-93291795 CCTAAAGTGCATAAAATCAAGCT No data
Right 1100299218 12:93291806-93291828 CACCATGAGCACATGTTCTCGGG 0: 2
1: 29
2: 491
3: 861
4: 1331
1100299212_1100299218 11 Left 1100299212 12:93291772-93291794 CCCTAAAGTGCATAAAATCAAGC No data
Right 1100299218 12:93291806-93291828 CACCATGAGCACATGTTCTCGGG 0: 2
1: 29
2: 491
3: 861
4: 1331
1100299210_1100299218 13 Left 1100299210 12:93291770-93291792 CCCCCTAAAGTGCATAAAATCAA No data
Right 1100299218 12:93291806-93291828 CACCATGAGCACATGTTCTCGGG 0: 2
1: 29
2: 491
3: 861
4: 1331
1100299211_1100299218 12 Left 1100299211 12:93291771-93291793 CCCCTAAAGTGCATAAAATCAAG No data
Right 1100299218 12:93291806-93291828 CACCATGAGCACATGTTCTCGGG 0: 2
1: 29
2: 491
3: 861
4: 1331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100299218 Original CRISPR CACCATGAGCACATGTTCTC GGG Intergenic
Too many off-targets to display for this crispr