ID: 1100299799

View in Genome Browser
Species Human (GRCh38)
Location 12:93296580-93296602
Sequence GCCTTAACATGTCTCTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100299799_1100299807 12 Left 1100299799 12:93296580-93296602 CCCAAGCAGAGACATGTTAAGGC No data
Right 1100299807 12:93296615-93296637 GAAAGACAGTCCAAGGAGGCGGG No data
1100299799_1100299812 27 Left 1100299799 12:93296580-93296602 CCCAAGCAGAGACATGTTAAGGC No data
Right 1100299812 12:93296630-93296652 GAGGCGGGGAGGATTCTGGCTGG No data
1100299799_1100299803 5 Left 1100299799 12:93296580-93296602 CCCAAGCAGAGACATGTTAAGGC No data
Right 1100299803 12:93296608-93296630 GATGCCAGAAAGACAGTCCAAGG No data
1100299799_1100299806 11 Left 1100299799 12:93296580-93296602 CCCAAGCAGAGACATGTTAAGGC No data
Right 1100299806 12:93296614-93296636 AGAAAGACAGTCCAAGGAGGCGG No data
1100299799_1100299809 16 Left 1100299799 12:93296580-93296602 CCCAAGCAGAGACATGTTAAGGC No data
Right 1100299809 12:93296619-93296641 GACAGTCCAAGGAGGCGGGGAGG No data
1100299799_1100299804 8 Left 1100299799 12:93296580-93296602 CCCAAGCAGAGACATGTTAAGGC No data
Right 1100299804 12:93296611-93296633 GCCAGAAAGACAGTCCAAGGAGG No data
1100299799_1100299808 13 Left 1100299799 12:93296580-93296602 CCCAAGCAGAGACATGTTAAGGC No data
Right 1100299808 12:93296616-93296638 AAAGACAGTCCAAGGAGGCGGGG No data
1100299799_1100299811 23 Left 1100299799 12:93296580-93296602 CCCAAGCAGAGACATGTTAAGGC No data
Right 1100299811 12:93296626-93296648 CAAGGAGGCGGGGAGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100299799 Original CRISPR GCCTTAACATGTCTCTGCTT GGG (reversed) Intergenic