ID: 1100302640

View in Genome Browser
Species Human (GRCh38)
Location 12:93322063-93322085
Sequence GGCTATGGCTGGAACCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100302636_1100302640 -6 Left 1100302636 12:93322046-93322068 CCAAGGTGGAAATAAGTGGCTAT No data
Right 1100302640 12:93322063-93322085 GGCTATGGCTGGAACCTAGTGGG No data
1100302634_1100302640 -4 Left 1100302634 12:93322044-93322066 CCCCAAGGTGGAAATAAGTGGCT No data
Right 1100302640 12:93322063-93322085 GGCTATGGCTGGAACCTAGTGGG No data
1100302627_1100302640 25 Left 1100302627 12:93322015-93322037 CCAGGCAACCAGAAGAGCAGGTG No data
Right 1100302640 12:93322063-93322085 GGCTATGGCTGGAACCTAGTGGG No data
1100302630_1100302640 17 Left 1100302630 12:93322023-93322045 CCAGAAGAGCAGGTGGAAGGACC No data
Right 1100302640 12:93322063-93322085 GGCTATGGCTGGAACCTAGTGGG No data
1100302635_1100302640 -5 Left 1100302635 12:93322045-93322067 CCCAAGGTGGAAATAAGTGGCTA No data
Right 1100302640 12:93322063-93322085 GGCTATGGCTGGAACCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100302640 Original CRISPR GGCTATGGCTGGAACCTAGT GGG Intergenic
No off target data available for this crispr