ID: 1100304918

View in Genome Browser
Species Human (GRCh38)
Location 12:93341608-93341630
Sequence GAGGAAACTGAGCTCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100304914_1100304918 -9 Left 1100304914 12:93341594-93341616 CCCATTTTATAGATGAGGAAACT No data
Right 1100304918 12:93341608-93341630 GAGGAAACTGAGCTCCAGGGAGG No data
1100304915_1100304918 -10 Left 1100304915 12:93341595-93341617 CCATTTTATAGATGAGGAAACTG No data
Right 1100304918 12:93341608-93341630 GAGGAAACTGAGCTCCAGGGAGG No data
1100304913_1100304918 -8 Left 1100304913 12:93341593-93341615 CCCCATTTTATAGATGAGGAAAC No data
Right 1100304918 12:93341608-93341630 GAGGAAACTGAGCTCCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100304918 Original CRISPR GAGGAAACTGAGCTCCAGGG AGG Intergenic