ID: 1100308555

View in Genome Browser
Species Human (GRCh38)
Location 12:93373408-93373430
Sequence CTGCATATAAACATGATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100308553_1100308555 7 Left 1100308553 12:93373378-93373400 CCAGTAAACATATTCATTAGCCA 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1100308555 12:93373408-93373430 CTGCATATAAACATGATGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100308555 Original CRISPR CTGCATATAAACATGATGCT TGG Intergenic
908404043 1:63796425-63796447 CTGCATTTTAACATGATCCCAGG + Intronic
912090561 1:106069648-106069670 TTGCATAGAAACATGAAGTTAGG + Intergenic
912470240 1:109901742-109901764 CTGCATGCATACAGGATGCTGGG - Intergenic
917798345 1:178548253-178548275 CTGCAGAGGAACATGAGGCTGGG - Intronic
922166656 1:223121137-223121159 CTACTTATAAAGAAGATGCTTGG - Intronic
923325344 1:232875510-232875532 TTACATATGAACATGGTGCTCGG - Intergenic
924826766 1:247547817-247547839 CTGCATTTTAACAGGATCCTCGG + Intronic
1064725087 10:18270895-18270917 ATACATATATACATAATGCTGGG + Intronic
1064955790 10:20907991-20908013 CTCCATATAAAAATGATGGGAGG + Intronic
1065013352 10:21439486-21439508 GTGCATAGAGACATGATGCATGG - Intergenic
1065703276 10:28445948-28445970 CTGCATTTTAACAAGATCCTTGG + Intergenic
1066077890 10:31898548-31898570 CTGCATATAAAAATGCAGTTGGG - Intronic
1072062235 10:91824684-91824706 TTGCAGATTAACATGAAGCTGGG + Intronic
1073749504 10:106508180-106508202 CCTCATATAAAAATGGTGCTGGG + Intergenic
1074047736 10:109854177-109854199 TTGCATATAAACACTATACTCGG + Intergenic
1078143939 11:8710457-8710479 ATGCATATACACATACTGCTGGG + Intronic
1078862318 11:15260774-15260796 ATGCATAAACACATGATGATGGG + Intergenic
1084011870 11:66355482-66355504 GTGCATATAAAAGTTATGCTTGG - Intronic
1084564832 11:69922750-69922772 CAGCATATGAACATGGGGCTTGG - Intergenic
1084655727 11:70516771-70516793 CTGAATATAAAAATGGGGCTGGG + Intronic
1085351265 11:75799325-75799347 TTGCATTTAAAAATGATCCTTGG + Intronic
1085962500 11:81478891-81478913 CTGCATGTAAACAGAATACTTGG - Intergenic
1086365362 11:86104488-86104510 CAGCATATTAAAATGAAGCTAGG + Intergenic
1087922373 11:103881128-103881150 CTTCATAGAAACTTGTTGCTTGG + Intergenic
1088775992 11:113083678-113083700 CTGCATTTTAACAAGATTCTTGG - Intronic
1090181041 11:124699696-124699718 CTGCATATAAAAAAGGCGCTAGG - Intergenic
1093784586 12:23177389-23177411 CTGCATCTGAAGATGAGGCTGGG - Intergenic
1093869268 12:24267297-24267319 CAAAATATAAACATGATGTTTGG - Intergenic
1094560022 12:31543615-31543637 CAGCATACAAACAAGTTGCTAGG + Intronic
1096749462 12:53749475-53749497 CATCAGGTAAACATGATGCTGGG - Intergenic
1098145793 12:67496686-67496708 CTGCAAATAAATATGACACTGGG - Intergenic
1100308555 12:93373408-93373430 CTGCATATAAACATGATGCTTGG + Intergenic
1101345778 12:103884976-103884998 ATGTGTATAAAGATGATGCTGGG - Intergenic
1103219821 12:119234435-119234457 GTGCATATAGAAATGATGTTGGG - Intergenic
1103246149 12:119459250-119459272 CTGCATTTTAACAGGATCCTCGG - Intronic
1104552919 12:129773952-129773974 ATGCATATAAACCTGGTCCTTGG + Intronic
1104763648 12:131313082-131313104 CTGCATAGGAGCATGAGGCTTGG - Intergenic
1105721338 13:23117947-23117969 CTGCATATTAACAGGAGGCCAGG + Intergenic
1106569560 13:30914981-30915003 CTCCATGTAAACAGGATGGTAGG + Intronic
1106711337 13:32337236-32337258 CAGCATATAAAAATGACTCTAGG + Exonic
1109393906 13:61728863-61728885 CTGTATATATGCATGATGATAGG + Intergenic
1112005949 13:95253811-95253833 CTCCATATAAACATAATACATGG + Intronic
1112007097 13:95263058-95263080 CTGCACTTGAGCATGATGCTTGG - Intronic
1112640079 13:101263247-101263269 GTGCATATAAACATGTTGATTGG - Intronic
1116200879 14:41793662-41793684 CTGTATATAATAGTGATGCTTGG - Intronic
1116817000 14:49593244-49593266 CTGCATATAACCACTATGCTAGG + Intronic
1118240218 14:64049119-64049141 CTGGATTTTAACATGATTCTTGG + Intronic
1120412360 14:84173861-84173883 GTGCATATAAACATGGTTGTAGG - Intergenic
1120738358 14:88080109-88080131 CTTCAAATAAACATGATTCATGG - Intergenic
1126601195 15:50429457-50429479 ATGAATATAAACATGCTGCTAGG - Intronic
1126627866 15:50702796-50702818 CTGCATATAAAAATGTTCATTGG - Exonic
1130690624 15:86078890-86078912 CTGCATTTAAACCAGATCCTCGG - Intergenic
1131652199 15:94412261-94412283 CTGCATATACACAGGATCCTTGG + Intronic
1131661978 15:94526946-94526968 CTGCATATTTACATGATGTTGGG + Intergenic
1135384265 16:22022418-22022440 CTGCATATAAACATTTGGATAGG - Intronic
1136663968 16:31792306-31792328 CTGCTTATTAACACGATGATGGG + Intronic
1137888759 16:52135899-52135921 TTGCATGAAAACGTGATGCTAGG + Intergenic
1137970192 16:52976987-52977009 CTGTATGAGAACATGATGCTGGG + Intergenic
1140473703 16:75228357-75228379 CTGCATATGAACATGGGCCTTGG - Intronic
1141305016 16:82854513-82854535 CTGCATTTAAAAATGATTCCAGG - Intronic
1145973622 17:28971645-28971667 CTGCATTTTAACAAGATCCTCGG + Intronic
1146628754 17:34455012-34455034 CTGCATTTAAACAAGATCCCAGG - Intergenic
1154368053 18:13729242-13729264 TTGGCTGTAAACATGATGCTTGG + Intronic
1156516503 18:37684853-37684875 CAGCATTTAAGGATGATGCTGGG - Intergenic
1158927928 18:62289373-62289395 CTGTATTAAAACATGATGGTAGG - Intronic
1159067647 18:63588049-63588071 CTGCATACAAACTTGACTCTGGG - Intronic
1159175397 18:64827332-64827354 GTGCATATAAAAGTTATGCTTGG + Intergenic
1162876017 19:13621653-13621675 CTGCATTTGAACTTGAGGCTGGG - Intronic
1166397324 19:42451182-42451204 CTGCATTTAAACAAGATCTTTGG - Intergenic
925075963 2:1015850-1015872 CAGCAGATACAGATGATGCTGGG - Intronic
926470118 2:13244847-13244869 ATGGATGTAAACATAATGCTTGG + Intergenic
926646402 2:15294415-15294437 CTGCATATAAACAGTATTCCTGG + Intronic
930228818 2:48822991-48823013 CTGCATTTTAACAAGATGCTGGG - Intergenic
931188733 2:59979099-59979121 CAGCATGTATAAATGATGCTAGG - Intergenic
931522495 2:63114177-63114199 CTGCATATAAACATTAGAATTGG + Intergenic
931908939 2:66873270-66873292 CTGCACACATAAATGATGCTAGG + Intergenic
931985404 2:67736736-67736758 CTGCACAGAAACATGAAGTTAGG - Intergenic
935868169 2:107415171-107415193 CTGCATAAGAACATTATTCTAGG - Intergenic
940925881 2:159363199-159363221 CTGCTTCTAAACTGGATGCTTGG + Intronic
941132091 2:161663977-161663999 AGGCAAAGAAACATGATGCTGGG + Intronic
942485082 2:176430560-176430582 CTTCATATACAAATCATGCTCGG - Intergenic
942891370 2:180993026-180993048 CTGCATTTAGACAAGATGCAAGG - Intronic
943695990 2:190931336-190931358 CTGCTTACTAACATGATCCTAGG - Intronic
945184096 2:207122265-207122287 CGGGATATAAACATTATGTTAGG + Intronic
945769929 2:214030745-214030767 CTGCAGATAAACGTGAGGTTAGG - Intronic
947349598 2:229229324-229229346 GTGAAAATAAACATGATGCATGG - Intronic
948031431 2:234820878-234820900 CTGCATCTAAACCTCATGCCTGG + Intergenic
1169763784 20:9127196-9127218 CTGCATTTTAACAAGATACTCGG - Intronic
1170387968 20:15841274-15841296 CAGCATCTAATCATGATGTTGGG + Intronic
1172967984 20:38852375-38852397 CTGCATAAAAACACAATGCCAGG - Intronic
949352739 3:3141268-3141290 CTGCATATAAACATGATTTCAGG + Intronic
949875313 3:8622888-8622910 CTGCATCCCAACATGATCCTGGG - Intronic
950834274 3:15904243-15904265 CTGCATTTTAACATGATCCACGG - Intergenic
951191020 3:19771723-19771745 CTGCATTTAAACAAGATTCCAGG + Intergenic
951233808 3:20211191-20211213 CTGCATATAGAAATGATATTGGG - Intergenic
951934455 3:28006378-28006400 CTGCATACAAAAAATATGCTAGG + Intergenic
952139009 3:30457839-30457861 TTACATATCAACATGAGGCTTGG - Intergenic
952266459 3:31791471-31791493 ATGCTTATAAAAATGATGCAAGG - Intronic
952830952 3:37564719-37564741 GTGCATGCAAACATGATGCTGGG + Intronic
952925894 3:38318961-38318983 CTGCAAATAAACATGGTCTTGGG + Intergenic
954424652 3:50437009-50437031 CTGCACACAGACATGGTGCTTGG - Intronic
955375348 3:58390738-58390760 CTGCATTTAAGCATGTTCCTGGG - Intronic
956199176 3:66688830-66688852 CTGAATACAAACAACATGCTTGG - Intergenic
957060389 3:75476558-75476580 CTGCATTTTAACAAGATGCCTGG + Intergenic
957840292 3:85659730-85659752 CTGCATTTTAACAAGATCCTGGG - Intronic
957847500 3:85756405-85756427 CTACATATATACATGATCATTGG + Intronic
960185886 3:114638264-114638286 TTGAACATAGACATGATGCTTGG + Intronic
961293003 3:125862852-125862874 CTGCATTTTAACAAGATGCCTGG - Intergenic
961979397 3:131061126-131061148 CTACATTTAAACAAGATCCTGGG + Intronic
968004050 3:195227165-195227187 CTGCTTTTGAACATGAAGCTGGG + Intronic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981218034 4:142194936-142194958 CTGAAAAGAAAAATGATGCTGGG + Intronic
984487744 4:180393373-180393395 CTACATTTAAGCATGATTCTAGG - Intergenic
984627252 4:182021103-182021125 GTACATATAAACATGAAGATGGG - Intergenic
985556010 5:558366-558388 CTGCATTTAAACAAGATCCCTGG - Intergenic
987119919 5:14757280-14757302 CTGCATATAAACTTGAGGTGGGG + Intronic
989059631 5:37397503-37397525 CTGCAAATAATAATGATGATGGG + Intronic
992022184 5:72635515-72635537 CTCCATATAGCCATGATCCTGGG - Intergenic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
993279975 5:85912865-85912887 CTGGACTTAAACTTGATGCTTGG + Intergenic
998215128 5:140232271-140232293 TTGTATATAAACCTGAAGCTTGG + Intronic
1001351328 5:170968821-170968843 CTGCATATAACCTTAATGTTAGG + Intronic
1002561599 5:180086040-180086062 CAGCAGATAAAAATGATGTTGGG - Intergenic
1004458750 6:15816443-15816465 ATGCATATAAATATGATGTCTGG - Intergenic
1004537037 6:16513173-16513195 ATGAAGATAAACATGTTGCTGGG - Intronic
1004811085 6:19263889-19263911 CTACTTATAAAAATGATACTAGG - Intergenic
1008770258 6:54970243-54970265 CTGCAACTCAACATGATGCAGGG + Intergenic
1011847795 6:91588333-91588355 CTGCATGTCAGCATTATGCTTGG + Intergenic
1012134969 6:95544351-95544373 ATGCAGATAAAAATGATGCTTGG + Intergenic
1012750370 6:103154474-103154496 TTGCATATATACATTATGCATGG - Intergenic
1013198583 6:107868044-107868066 ATCCATTTAAACTTGATGCTAGG - Exonic
1015477149 6:133666827-133666849 GTACATATGAACATAATGCTGGG + Intergenic
1015545183 6:134354649-134354671 CTGTACATAAACATTATACTTGG - Intergenic
1017087950 6:150731925-150731947 CAGCATTTAAATATGATGTTGGG - Intronic
1019763367 7:2830662-2830684 CTGCAAGGAAACATGAGGCTAGG + Intronic
1020621314 7:10522945-10522967 CTGCATATCAACTAGATCCTGGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026465292 7:70648508-70648530 CTACATCTAAACATGCTACTAGG - Intronic
1027726988 7:81819163-81819185 CTGCATATTAACATGATTGGCGG + Intergenic
1028099711 7:86804809-86804831 CTGCATTTAAAGAGGATGGTAGG + Intronic
1029910709 7:104144458-104144480 GTGCATTTAAAAATGAGGCTGGG + Intronic
1029982311 7:104890483-104890505 CTGCATGTAAACAGTAAGCTAGG - Intronic
1031916689 7:127569757-127569779 TTGCATAAAAACATGTTTCTGGG - Intergenic
1032697020 7:134345908-134345930 CTGCATAAGAGCATGCTGCTGGG + Intergenic
1034308361 7:150065060-150065082 CTAGATAAAAGCATGATGCTGGG + Intergenic
1034798492 7:154035613-154035635 CTAGATAAAAGCATGATGCTGGG - Intronic
1035076660 7:156182263-156182285 CTGCAGGTATACATTATGCTTGG + Intergenic
1036080309 8:5548043-5548065 CAGCATATACACATGGTGCAAGG - Intergenic
1037667854 8:20986154-20986176 CTGCCTAAAAAGATGATGCCAGG + Intergenic
1037707739 8:21329858-21329880 CTGAATATGAACAGGTTGCTGGG - Intergenic
1038081807 8:24146072-24146094 CTGCATAATAACATGATGTAAGG + Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039297851 8:36176554-36176576 TTGTATATAAATATTATGCTTGG + Intergenic
1041348523 8:56926133-56926155 CTGCATTTTAACAAGATCCTAGG + Intergenic
1043581082 8:81716000-81716022 CTGCATAAAATCAACATGCTAGG + Intronic
1044236489 8:89837050-89837072 CTGCACATAAACAGGATGTGTGG - Intergenic
1045713979 8:105020062-105020084 CTGCATATAAAAATTATTATGGG - Intronic
1050434890 9:5598589-5598611 ATGCTTTTAACCATGATGCTAGG + Intergenic
1056853221 9:90102434-90102456 CTGCATATAAACAGCCTGATTGG + Intergenic
1058444747 9:105044916-105044938 CTGCATTTAAACAAGTTGGTAGG + Intergenic
1187820632 X:23284197-23284219 CTTCTTATAAACATAATGTTTGG - Intergenic
1188406555 X:29817881-29817903 CTGGATATAGATATGATGCCTGG - Intronic
1189496740 X:41515520-41515542 CTGCAATTAAACACGATACTCGG + Intronic
1190164056 X:48056959-48056981 CTGCAAAGAAGCATGATGGTAGG - Intronic
1192811897 X:74554528-74554550 CAGCATTTAACCTTGATGCTAGG + Intergenic
1194235251 X:91374951-91374973 CTGCATAACAACATGATGGCAGG + Intergenic
1194344182 X:92742596-92742618 CTGCAAATAAACATGTTCTTTGG - Intergenic
1194399094 X:93421091-93421113 CTCCATTTAATCATGATCCTAGG + Intergenic
1194830047 X:98612576-98612598 CTGCATATGAGCAGGATGCTTGG + Intergenic
1195258510 X:103111116-103111138 CAGCATTTAACCATGATCCTAGG - Intergenic
1198080884 X:133238302-133238324 CTACATATAAATGTAATGCTGGG - Intergenic
1198990770 X:142512567-142512589 ATGCATATACACATGATCATGGG - Intergenic
1198998996 X:142610281-142610303 TTTCATATAAAAATGATTCTAGG + Intergenic
1200652529 Y:5859248-5859270 CTGCAAATAAACATGTTCTTTGG - Intergenic