ID: 1100309818

View in Genome Browser
Species Human (GRCh38)
Location 12:93383886-93383908
Sequence AGTGACCCCTAAGAATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100309818_1100309823 16 Left 1100309818 12:93383886-93383908 CCTCTTCATTCTTAGGGGTCACT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1100309823 12:93383925-93383947 GCTCCTCCGCTCCCCTTCCCGGG 0: 1
1: 0
2: 9
3: 42
4: 488
1100309818_1100309822 15 Left 1100309818 12:93383886-93383908 CCTCTTCATTCTTAGGGGTCACT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1100309822 12:93383924-93383946 GGCTCCTCCGCTCCCCTTCCCGG 0: 1
1: 0
2: 7
3: 35
4: 358
1100309818_1100309820 -10 Left 1100309818 12:93383886-93383908 CCTCTTCATTCTTAGGGGTCACT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1100309820 12:93383899-93383921 AGGGGTCACTTGAGGTTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 133
1100309818_1100309821 -6 Left 1100309818 12:93383886-93383908 CCTCTTCATTCTTAGGGGTCACT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1100309821 12:93383903-93383925 GTCACTTGAGGTTCTCTGGATGG 0: 1
1: 0
2: 0
3: 19
4: 123
1100309818_1100309827 27 Left 1100309818 12:93383886-93383908 CCTCTTCATTCTTAGGGGTCACT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1100309827 12:93383936-93383958 CCCCTTCCCGGGAACAGAAGTGG 0: 1
1: 0
2: 2
3: 22
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100309818 Original CRISPR AGTGACCCCTAAGAATGAAG AGG (reversed) Intronic