ID: 1100309820

View in Genome Browser
Species Human (GRCh38)
Location 12:93383899-93383921
Sequence AGGGGTCACTTGAGGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100309818_1100309820 -10 Left 1100309818 12:93383886-93383908 CCTCTTCATTCTTAGGGGTCACT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1100309820 12:93383899-93383921 AGGGGTCACTTGAGGTTCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100309820 Original CRISPR AGGGGTCACTTGAGGTTCTC TGG Intronic