ID: 1100309827 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:93383936-93383958 |
| Sequence | CCCCTTCCCGGGAACAGAAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 189 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 22, 4: 164} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1100309818_1100309827 | 27 | Left | 1100309818 | 12:93383886-93383908 | CCTCTTCATTCTTAGGGGTCACT | 0: 1 1: 0 2: 0 3: 12 4: 108 |
||
| Right | 1100309827 | 12:93383936-93383958 | CCCCTTCCCGGGAACAGAAGTGG | 0: 1 1: 0 2: 2 3: 22 4: 164 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1100309827 | Original CRISPR | CCCCTTCCCGGGAACAGAAG TGG | Intronic | ||