ID: 1100313346

View in Genome Browser
Species Human (GRCh38)
Location 12:93418660-93418682
Sequence TCTGTTGGATAGCAGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100313346 Original CRISPR TCTGTTGGATAGCAGTGCTG TGG (reversed) Intronic
900130994 1:1087204-1087226 ACTGTGGGATAGCAGAACTGTGG + Exonic
900963574 1:5941895-5941917 TCTGTGGGAAAGCTGGGCTGGGG + Intronic
901442820 1:9289795-9289817 GCTGATGAATAGCAGAGCTGGGG + Intergenic
903689253 1:25159665-25159687 TGTGTTGGAAAGCAGAGATGAGG + Intergenic
905334469 1:37234905-37234927 GCATTTGGGTAGCAGTGCTGGGG - Intergenic
908891725 1:68856731-68856753 TATGTTGAATAGGAGTGGTGAGG + Intergenic
911070042 1:93825277-93825299 TCAGGTGGATAGCTGTGCTGGGG - Intronic
912952480 1:114129715-114129737 TCTGATGGATCACAGTGCAGTGG + Intronic
913512891 1:119578297-119578319 TGTGTTGAATAGGAGTGGTGAGG - Intergenic
914229578 1:145753238-145753260 TCTGTAAGATAGCAGAGCTCAGG - Intronic
914912423 1:151798680-151798702 TCTGTTGGGTAGCTCTGCTCTGG + Intergenic
917578536 1:176349454-176349476 CCTGTTGGCTGGCACTGCTGGGG + Intergenic
919304875 1:195819446-195819468 TATGTTGAATAGGAGTGGTGAGG + Intergenic
919798445 1:201336089-201336111 CCTGGAGGATAGCAGGGCTGTGG + Intergenic
920064931 1:203262062-203262084 TATGTTGAATAGGAGTGGTGAGG - Intronic
921038314 1:211404326-211404348 TATGTTGAATAGGAGTGGTGAGG + Intergenic
923550951 1:234962782-234962804 TCTGTTGGCTAGCTGTGTGGGGG - Intergenic
1063819408 10:9817816-9817838 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1064702120 10:18032683-18032705 TATGTTGAATAGGAGTGGTGAGG + Intronic
1065080610 10:22125944-22125966 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1065247523 10:23773993-23774015 TATGTTGAATAGGAGTGGTGAGG + Intronic
1065396934 10:25249345-25249367 TATGTTGAATAGGAGTGGTGAGG + Intronic
1066139015 10:32484530-32484552 TATGTTGAATAGGAGTGGTGAGG + Intronic
1067211134 10:44261121-44261143 CCTGTTCCATAGCAGTGATGAGG + Intergenic
1068470827 10:57460809-57460831 TATGATGGAGATCAGTGCTGTGG + Intergenic
1068738295 10:60439627-60439649 TCAGTTGGATGGCATTCCTGAGG - Intronic
1069356604 10:67593792-67593814 TATGTTGAATAGGAGTGATGAGG + Intronic
1070062107 10:72993986-72994008 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1070065042 10:73025570-73025592 TATGTTGAATAGGAGTGGTGAGG - Intronic
1071101749 10:82046602-82046624 TATGTTGAATAGGAGTGGTGAGG + Intronic
1071254158 10:83853801-83853823 TCTGATGATTAGCAGTGTTGAGG - Intergenic
1071332192 10:84571370-84571392 CCTGTTGGCCAGCACTGCTGGGG - Intergenic
1072605041 10:96973987-96974009 TCTGATGGAAAGCATTCCTGTGG - Intronic
1073622174 10:105061158-105061180 TTTGTTGGAAAGCTGTGCTCTGG + Intronic
1074042585 10:109806602-109806624 AATGTTGAATAGCAGTGGTGAGG - Intergenic
1076058534 10:127395128-127395150 TCTGGGAGATAGCAGTGCAGGGG + Intronic
1076390232 10:130094834-130094856 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1076692578 10:132231216-132231238 TCTGGTGGACAGCAGAGCCGTGG - Intronic
1079401161 11:20107536-20107558 TCTGAGGGATGGCAGGGCTGAGG - Intronic
1080906232 11:36548232-36548254 TATGTTGAATAGGAGTGGTGAGG - Intronic
1081241064 11:40707244-40707266 TATGTTGAATAGGAGTGGTGAGG + Intronic
1082951416 11:58820054-58820076 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1083598343 11:63930915-63930937 TCTGCTGGAGTGCAGTGCAGTGG - Intergenic
1084406071 11:68974437-68974459 CCAGTGGGATAGCACTGCTGGGG + Intergenic
1086565383 11:88220231-88220253 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1086567611 11:88244569-88244591 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1087881642 11:103422794-103422816 TATGTTGAATAGGAGTGGTGAGG - Intronic
1090724211 11:129508595-129508617 TATGTTGAATAGCAGTGATAAGG + Intergenic
1091622423 12:2099442-2099464 TCTGTTTGCCTGCAGTGCTGGGG + Intronic
1093152590 12:15640373-15640395 CCTGGTGGATAGCAGAGCTGTGG + Intronic
1093388425 12:18587164-18587186 TATGTTGAATAGGAGTGATGAGG - Intronic
1093413272 12:18892256-18892278 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1093693488 12:22134093-22134115 TATGTTGAATAGGAGTGATGAGG - Intronic
1095608184 12:44095824-44095846 TATGTTGAATAGGAGTGGTGAGG - Intronic
1097674585 12:62584992-62585014 TATGTTGAATAGAAGTGATGAGG + Intronic
1097910340 12:64962758-64962780 TATGTTGAATAGCAGTGTTGAGG + Intergenic
1099031206 12:77527855-77527877 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1099426083 12:82524224-82524246 TCTGTTGGACAGCATTTCTGAGG - Intergenic
1099695997 12:86020225-86020247 TATGTTGAATAGGAGTGTTGAGG + Intronic
1100313346 12:93418660-93418682 TCTGTTGGATAGCAGTGCTGTGG - Intronic
1100762601 12:97825890-97825912 TCTGTTGGATAGGACTGCCGTGG + Intergenic
1100998594 12:100331162-100331184 TATCTTGGATAGCAGAGTTGAGG + Intronic
1101595230 12:106158801-106158823 TCTGTTCCATTGCATTGCTGAGG + Intergenic
1102847848 12:116206688-116206710 TCAGTTGTATATCAGTGCTTTGG - Intronic
1103357355 12:120331590-120331612 TCTGTTGGACAGGGCTGCTGTGG + Intergenic
1103632154 12:122270279-122270301 TCTGTTGCCTAGGAGTGCAGTGG + Intergenic
1105702918 13:22947230-22947252 GCTAGTGCATAGCAGTGCTGTGG + Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1106016356 13:25872709-25872731 TCTATTGGACAGCACTGCTCAGG - Intronic
1108815285 13:54283360-54283382 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1109774785 13:67026521-67026543 TATGTTGAATAGGAGTGGTGAGG - Intronic
1109941295 13:69369435-69369457 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1110606580 13:77439856-77439878 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1111605346 13:90531450-90531472 TCTGTTGGAAAACAGATCTGTGG + Intergenic
1112592850 13:100779890-100779912 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1112645296 13:101324809-101324831 TATGTTGAATAGGAGTGGTGAGG + Intronic
1113537194 13:111077029-111077051 TCTGTTGAATATCAGTGTTCTGG + Intergenic
1113563526 13:111303132-111303154 TCTGTTGAAGACCAGTTCTGAGG + Intronic
1114393185 14:22332085-22332107 TCTGTTGGGGTGCAGTGCTTAGG - Intergenic
1116323400 14:43498281-43498303 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1117619480 14:57569792-57569814 TCTGTGGGATGGCAGGGCTGTGG - Exonic
1118323912 14:64768899-64768921 TTTGCTGAAGAGCAGTGCTGTGG + Intronic
1120868369 14:89315599-89315621 TCTGTTCGACAGCAATTCTGGGG - Intronic
1122433327 14:101672739-101672761 TCTGTTGAATAGAACTGGTGAGG - Intergenic
1124802204 15:32844161-32844183 TCTGTTTGAAAGCAGAGCTGGGG + Intronic
1126502201 15:49358194-49358216 TATGTTGAATAGGAGTGGTGAGG - Intronic
1126661056 15:51033653-51033675 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1126973233 15:54143010-54143032 TCTTTCAGATAGCAGTTCTGTGG + Exonic
1128428834 15:67571852-67571874 TTTATTGGATAGCAGTTCTCTGG + Intronic
1128802747 15:70507294-70507316 TCTGTTGCCCAGCAGTGCTCTGG + Intergenic
1128838877 15:70833328-70833350 TCTGTTGGACAACACTGCTGTGG - Intronic
1130179995 15:81616531-81616553 TCTGTTTGATACCAGTTCTTTGG + Intergenic
1131790842 15:95963326-95963348 TCTGTTGCCTAGGACTGCTGTGG - Intergenic
1134187130 16:12093300-12093322 GCTCTTGAACAGCAGTGCTGTGG - Intronic
1135156339 16:20056179-20056201 TGGGTTGGGGAGCAGTGCTGGGG - Intronic
1135779529 16:25288163-25288185 TATGTTGAATAGCAGTGGTGAGG + Intergenic
1135967875 16:27051001-27051023 TCGGTTGGAGTGCAGTGGTGCGG - Intergenic
1136085865 16:27884628-27884650 TCTGTTGGACAGGGGTCCTGTGG - Exonic
1137510650 16:49097017-49097039 TCTGCTGGCTAGCAGAGCAGTGG - Intergenic
1139276215 16:65729855-65729877 CCTGTTTCATAGCATTGCTGGGG + Intergenic
1140163734 16:72527328-72527350 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1140818839 16:78644766-78644788 TTTGTTGGATAAAAGTGCCGAGG - Intronic
1142929335 17:3269344-3269366 TCTATTGGATAGCACTGCTCTGG + Intergenic
1144432305 17:15204957-15204979 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1144792073 17:17866071-17866093 TATGTTGGAAAGCAGGGATGGGG - Intronic
1144814808 17:18026515-18026537 TCTGGTGGAGGGCTGTGCTGTGG - Intronic
1145002240 17:19313406-19313428 CCAGTTGGATATCACTGCTGAGG - Intronic
1145906800 17:28520834-28520856 TCTGCAGGGGAGCAGTGCTGGGG + Intronic
1147936290 17:44013089-44013111 TGTGTTGGCCAGCGGTGCTGGGG - Exonic
1148524846 17:48321754-48321776 GGTGTTGGTGAGCAGTGCTGAGG - Intronic
1149014961 17:51898099-51898121 TATGTTGAATAGAAGTGGTGAGG + Intronic
1153090705 18:1339307-1339329 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1153677016 18:7464913-7464935 TCTGTTGGACAGCAATGGTTAGG - Intergenic
1153836994 18:8972213-8972235 TCTGTTTGACAGCAGTACTTTGG - Intergenic
1153857747 18:9167751-9167773 TGTGTTGAATAGGAGTGGTGAGG + Intronic
1155789542 18:29948476-29948498 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1156503931 18:37577294-37577316 TTTGTTGGAAATCAGTGTTGGGG + Intergenic
1157031215 18:43910659-43910681 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1157316530 18:46594430-46594452 TCTGCTGGATACCAGTGAAGGGG + Intronic
1157396968 18:47350261-47350283 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1157510018 18:48264567-48264589 TGTGCTGGAAAGCAGTGCTTTGG + Intronic
1159637048 18:70817818-70817840 TATGTTTAATAGCAGTGGTGAGG - Intergenic
1160629527 18:80236459-80236481 TATGTTGAATAGGAGTGGTGAGG - Intronic
1160705598 19:528781-528803 TCTCTGGGATCACAGTGCTGGGG - Intergenic
1160754220 19:749282-749304 TGTGGTGGAGAGCACTGCTGAGG + Intergenic
1160974597 19:1786681-1786703 TGTGTTGGATTGCATAGCTGTGG + Intronic
1162013811 19:7832831-7832853 GCTGTCGGATAGCCATGCTGAGG + Intronic
1162122068 19:8476901-8476923 TCTGCTGGATAGCAGAGCCCAGG - Intronic
1162243189 19:9374877-9374899 TATGTTGAATAGAAGTGGTGAGG + Intronic
1163134503 19:15299883-15299905 TCTGTAGAACAGCAGTTCTGTGG - Intronic
1165412988 19:35673664-35673686 TCTCTAGGAGAGCAGGGCTGCGG + Intronic
1165596915 19:37016680-37016702 GCTACTGGACAGCAGTGCTGAGG + Intronic
1165634031 19:37325360-37325382 TCTATTGGAAAGCACTGCTCTGG - Intronic
1166316434 19:41992284-41992306 TCTGTTGGAGTGCACAGCTGAGG + Intronic
1166542002 19:43611745-43611767 TGTGATGGAGAGCAGTGCAGGGG - Intronic
1167771144 19:51519552-51519574 TCTCTTGGACAGAAGTCCTGTGG + Intronic
925284655 2:2708037-2708059 TGTCTTGGATGGCAGAGCTGTGG + Intergenic
925358004 2:3256190-3256212 TATGGAGGAGAGCAGTGCTGAGG - Intronic
925788817 2:7461143-7461165 CATGTTGAATAGCAGTGGTGAGG + Intergenic
930948044 2:57100004-57100026 TGTGTTGAATAACAGTGGTGAGG + Intergenic
931554014 2:63479769-63479791 TATGTTGAATAGAAGTGTTGAGG - Intronic
933774134 2:85761643-85761665 TCTGTGTGAAAACAGTGCTGAGG + Intronic
937608194 2:123826932-123826954 TGGGTGGGCTAGCAGTGCTGGGG + Intergenic
937851356 2:126639177-126639199 GCTTTTGGAGAGCAGGGCTGTGG - Intergenic
939157307 2:138540776-138540798 TATGTTGAATAGGAGTGGTGAGG + Intronic
939911140 2:147984608-147984630 TCTGATGTATAGTAGTGCTCTGG - Intronic
941404578 2:165073136-165073158 AATGTTGGATAGAAGTGGTGAGG - Intergenic
943352844 2:186815931-186815953 TGTGTTGAATAGGAGTGGTGAGG - Intergenic
944496759 2:200315073-200315095 TCTGTTGGACAGCATTGTTAGGG + Intronic
946916263 2:224525702-224525724 TCTTTTGAGTAGCAGTGTTGGGG + Intronic
946945050 2:224812520-224812542 TATGTTGAATAGGAGTGGTGAGG + Intronic
948233849 2:236371863-236371885 TCTGGTGTAAAGCATTGCTGTGG + Intronic
1170059298 20:12242757-12242779 TCTATTGGATAGCATTGCTCTGG - Intergenic
1170070548 20:12361598-12361620 TATGTTGAATAGAAGTGGTGAGG + Intergenic
1172601245 20:36185040-36185062 TCTGATGGACAGCTGTGCTTGGG + Intronic
1173137483 20:40452046-40452068 TATGTTGGACAGCATAGCTGTGG - Intergenic
1173347494 20:42214396-42214418 TCTGTTGGGTACCAATTCTGGGG + Intronic
1173717061 20:45217654-45217676 TCTGAAGGATAGCTTTGCTGAGG + Intergenic
1174491736 20:50903258-50903280 TCTGTGGGATAGCCATGCAGTGG - Intronic
1176344088 21:5725088-5725110 TATCTTGAATAGGAGTGCTGAGG + Intergenic
1176500739 21:7599368-7599390 TATCTTGAATAGGAGTGCTGAGG - Intergenic
1176538409 21:8123157-8123179 TATCTTGAATAGGAGTGCTGAGG + Intergenic
1176865726 21:14053730-14053752 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1178943701 21:36928693-36928715 TTTCTTGGATATCTGTGCTGTGG - Intronic
1181169043 22:20998100-20998122 TGTGGTGGGTAGCACTGCTGTGG - Exonic
1182715960 22:32356424-32356446 CCTGTTGGATAGCAGCCCGGGGG - Intronic
1183423384 22:37724998-37725020 TCTGTTGAATACAAGTTCTGGGG - Exonic
1184460494 22:44635097-44635119 TCTGTGGGCTTGCAGCGCTGGGG + Intergenic
1184870320 22:47233658-47233680 TATGATGGAAAGCAGTGGTGGGG + Intergenic
950170035 3:10832612-10832634 TCTCTTAGAGAGCAGGGCTGGGG - Intronic
950822867 3:15780032-15780054 TATGGTGGATAGGAGTGGTGAGG - Intronic
950833897 3:15901399-15901421 TCTGTTGCCCAGGAGTGCTGTGG + Intergenic
951827581 3:26885462-26885484 TATGTTGAATAGCAGTGGTGAGG - Intergenic
951991770 3:28683295-28683317 TCTGGTGGCTAGGAGTGGTGGGG + Intergenic
952191189 3:31025048-31025070 AATGTTGGATGGCACTGCTGGGG + Intergenic
952552106 3:34490521-34490543 TCTATTGGACAGCAATACTGTGG - Intergenic
953243383 3:41169187-41169209 TCTGTTGGATGGCACTGATGTGG + Intergenic
953916316 3:46923171-46923193 ACTGTTGGAAACCAGTGCTGAGG - Intronic
955833433 3:63028439-63028461 TATGTTGAATAGAAGTGGTGAGG + Intergenic
957005002 3:74934714-74934736 TATGTTGAATAGGAGTGGTGAGG + Intergenic
957815660 3:85293896-85293918 TATGTTGAATAGGAGTGGTGAGG - Intronic
958255125 3:91316663-91316685 TATGTTGAATAGGAGTGGTGAGG + Intergenic
958706640 3:97664428-97664450 TATGTTGAATAGGAGTGGTGAGG - Intronic
960433275 3:117595680-117595702 TCTGTTTGATCCCAGTTCTGTGG + Intergenic
960770525 3:121188916-121188938 TATGTTGAATAGGAGTGGTGAGG - Intronic
962453161 3:135538814-135538836 GCTGTTGCATAACAGTGTTGGGG - Intergenic
962651455 3:137497954-137497976 GTTGGTGGATAGCAGTGCTATGG + Intergenic
962656339 3:137547743-137547765 TATGTTGAATAGGAGTGGTGAGG - Intergenic
964053528 3:152424036-152424058 TATGTTGAATAGGAGTGGTGAGG - Intronic
964190788 3:153998716-153998738 TATGTTGAATAGGAGTGGTGAGG - Intergenic
965652126 3:170945638-170945660 TATGTTGAATAGAAGTGGTGGGG + Intergenic
968460939 4:724396-724418 CCTGGTGGACAGCGGTGCTGTGG + Intronic
970155043 4:13133222-13133244 TATGTTGAATAGGAGTGGTGAGG + Intergenic
970555588 4:17228491-17228513 TATGTTGAATAGGAGTGGTGAGG + Intergenic
971100855 4:23465264-23465286 TGTGTGGGATACCAGGGCTGTGG + Intergenic
972127427 4:35786842-35786864 TGTGTTGAATAGCAGTAGTGAGG - Intergenic
972723561 4:41725356-41725378 GCTGTTGAAAAGCAGTGGTGAGG + Intergenic
973064735 4:45774518-45774540 TATGTTGAATAGGAGTGGTGAGG + Intergenic
973132427 4:46664188-46664210 TATGTTGAATAGGAGTGGTGAGG + Intergenic
973886385 4:55326164-55326186 CCTGGTGGATAGCAATGTTGAGG + Intergenic
975400151 4:73927857-73927879 TATGTTGAATAGGAGTGGTGAGG - Intergenic
976059712 4:81112878-81112900 TCTGTTGTCTAGAAGAGCTGGGG - Intronic
976294596 4:83456894-83456916 TCTGTTTAATCGCAGTGCTTTGG + Exonic
976552233 4:86409935-86409957 TATGTTGAATAGCAGTGGTGAGG + Intronic
976821963 4:89216638-89216660 TCTGTGGAATAGCAGAACTGTGG + Intergenic
977117887 4:93055275-93055297 TCTGTGGTCTAGCAGTGATGAGG + Intronic
977479917 4:97562475-97562497 TATGTTGAATAGGAGTGGTGAGG + Intronic
978664675 4:111168144-111168166 TATGTTGAATAGGAGTGGTGAGG - Intergenic
979048622 4:115901603-115901625 TATGTTGAATAGGAGTGGTGAGG - Intergenic
979141799 4:117184695-117184717 TATGTTGAATAGGAGTGGTGAGG - Intergenic
979930342 4:126622173-126622195 TATGTTGAATAGCAGTGGTGAGG - Intergenic
980395517 4:132208789-132208811 TATGTTGAATAGGAGTGGTGAGG - Intergenic
983048817 4:163019806-163019828 TATGTTGAATAGGAGTGGTGAGG + Intergenic
983314507 4:166113487-166113509 TATGTTGAATAGAAGTGGTGAGG + Intergenic
984457240 4:179985888-179985910 TATGTTGAATAGGAGTGGTGAGG + Intergenic
984485288 4:180360397-180360419 TATGTTGAATAGGAGTGGTGAGG + Intergenic
984967598 4:185153891-185153913 TCTGTTGAATAGGAGTGGTGAGG - Intergenic
985881976 5:2645226-2645248 TCTGTTGGAACCCAGTTCTGTGG - Intergenic
987223296 5:15813163-15813185 TATGTTGAATAGGAGTGGTGAGG + Intronic
988014770 5:25540320-25540342 TCTGTGTCATAGCGGTGCTGGGG + Intergenic
988598650 5:32619101-32619123 CCTGTTGGATAGCACTGCACTGG - Intergenic
990037748 5:51342711-51342733 TCTTTTGAAAAGCATTGCTGAGG - Intergenic
990239948 5:53806876-53806898 TATGTTGAATAGGAGTGGTGAGG - Intergenic
990375690 5:55168196-55168218 TCTCTTGCAGAGCAGTGCAGGGG + Intronic
990770482 5:59238595-59238617 TCTGTTCAATAGTAGGGCTGGGG - Intronic
990905675 5:60800748-60800770 TATGTTGAATAGAAGTGGTGAGG - Intronic
992065817 5:73106953-73106975 TCTTTTTGATAGCAGTCATGAGG + Intergenic
992675064 5:79097928-79097950 TATGTTGAATAGGAGTGGTGAGG + Intronic
992737378 5:79736305-79736327 TCATTTTGATAGAAGTGCTGTGG - Exonic
992842536 5:80710554-80710576 TCTGCTGGATACCAGGGCTGTGG - Intronic
994052267 5:95375759-95375781 TCTGTTAGAAAGCAGCGCAGGGG - Intergenic
995664377 5:114524701-114524723 TATGTTGAATAGGAGTGGTGAGG - Intergenic
997311098 5:132883550-132883572 TCTGTTGTGTAGCAAAGCTGTGG - Exonic
997616545 5:135250021-135250043 TCTGATGGATAGCACTGCCCTGG - Intronic
997802436 5:136878806-136878828 TATGTTGAATAGGAGTGGTGAGG - Intergenic
997816827 5:137027428-137027450 TATATTGGATAGCACTGCTCTGG - Intronic
999376281 5:151088560-151088582 TCTATTGGATAGCACTGCTCTGG + Intronic
999421137 5:151444981-151445003 TATGTTGAATAGAAGTGGTGAGG + Intronic
1000244172 5:159435615-159435637 TCTGTTGAACAGCACTGCTCTGG + Intergenic
1000378817 5:160610275-160610297 CATGTTGTATAGCAGTCCTGTGG + Intronic
1001839335 5:174860984-174861006 TGTGTTGAATAGGAGTGGTGAGG + Intergenic
1002954044 6:1844177-1844199 TTGGTTGAATAGCAGAGCTGGGG + Intronic
1003239447 6:4330773-4330795 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1003395246 6:5747402-5747424 GTGGTTGGATAGCAGTGATGAGG + Intronic
1005360363 6:25025379-25025401 TCTGTTGAATAACAGTGCTCTGG + Intronic
1005912205 6:30320541-30320563 TCTATTGGACAGCACTGCTCTGG + Intergenic
1010100716 6:72104428-72104450 TCTGTTGGATGGCAGGTATGTGG - Intronic
1010310096 6:74375076-74375098 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1010797747 6:80137583-80137605 TTTGTAGGATATCAGAGCTGGGG + Intronic
1011774636 6:90716144-90716166 CCTGTTTGATAGGAGTGGTGAGG - Intergenic
1012250947 6:96980196-96980218 TATGTTGAATAGGAGTGCTGAGG + Intronic
1012584900 6:100910154-100910176 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1014094811 6:117448117-117448139 TCTGATGAATAGCAGCTCTGTGG + Intronic
1015802452 6:137074250-137074272 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1016118663 6:140320365-140320387 TGTGTTGAACAACAGTGCTGGGG + Intergenic
1017521943 6:155210129-155210151 TCTATTGGAGAAGAGTGCTGAGG + Intronic
1017522882 6:155217300-155217322 TCTTTTGGATACCCGTTCTGTGG + Intronic
1018576078 6:165261778-165261800 CATGTTGGATAGCAGAGGTGCGG + Intergenic
1021600627 7:22359603-22359625 TCTGTTGGACAGCATTGCAGAGG - Intergenic
1023892732 7:44405031-44405053 TCTCTTGTACAGCAGTCCTGGGG - Intronic
1025016789 7:55445952-55445974 TCTATTGGATAACACTGTTGTGG + Intronic
1025153341 7:56578583-56578605 AGTGTTGGATAGTAGAGCTGTGG + Intergenic
1025819724 7:64950820-64950842 CCTGTTGGAAAGGAGTGCTGTGG + Intergenic
1027128916 7:75576822-75576844 TCTATTGGATAGCACTATTGTGG - Intronic
1028708464 7:93878980-93879002 ACTGTTGAATAGAAGTGCAGAGG + Intronic
1029837183 7:103325136-103325158 TTTGTTTTATAGCAGTGCTGAGG - Intronic
1030185866 7:106761246-106761268 TCTGTGGGAAAGCAGTTGTGGGG - Intergenic
1032135375 7:129272087-129272109 TCTTTTGGATTGCTGTGCTATGG + Intronic
1032661024 7:133983830-133983852 TCTGTTGAAAAGCAGTATTGTGG - Intronic
1032966728 7:137106276-137106298 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1034442248 7:151091778-151091800 TCTGTGGGGTACCACTGCTGGGG - Intronic
1034889386 7:154826615-154826637 GCTGTTGGACAACAGTGCCGAGG - Intronic
1036699390 8:11001940-11001962 TCTGCTGGAAGGAAGTGCTGTGG - Intronic
1038531326 8:28320220-28320242 ACTGTGGGATGGCAGAGCTGGGG - Intronic
1038870258 8:31486132-31486154 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1038894186 8:31762665-31762687 AATGCTGGATAGCAGTGATGAGG + Intronic
1039733817 8:40308274-40308296 TCTGTAGAATAGCAGTGCCAGGG + Intergenic
1040693765 8:49971472-49971494 TATGTTGAATAGGAGTGGTGAGG - Intronic
1041994554 8:64038295-64038317 TCTGTAGGATATAACTGCTGTGG + Intergenic
1042932072 8:74023429-74023451 ACTGTTGAATAGCAGGCCTGTGG + Intronic
1044129268 8:88500197-88500219 TGTGTTGAATAGGAGTGGTGAGG + Intergenic
1044333572 8:90949283-90949305 TCAGTTGTATAGCAGTAGTGTGG + Intronic
1046565266 8:115891582-115891604 TCTGATGGATAGTAGTACAGGGG - Intergenic
1046706222 8:117455381-117455403 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1046756684 8:117979759-117979781 TCTGTTCTATTGCAGTGCTTTGG - Intronic
1048122357 8:131596076-131596098 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1048468923 8:134689857-134689879 TCTGTTGGACAGCAGTGGCCTGG - Intronic
1049023811 8:139974990-139975012 TCTGATGGGGTGCAGTGCTGGGG - Intronic
1050661129 9:7884030-7884052 TGTGTTGAATAGGAGTGGTGAGG - Intronic
1051113620 9:13668668-13668690 TATGTTGAATAGAAGTGGTGTGG - Intergenic
1051549106 9:18309294-18309316 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1051702360 9:19837525-19837547 TGTGTTGAATAGGAGTGGTGAGG - Intergenic
1052632030 9:31053506-31053528 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1052632360 9:31058101-31058123 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1052936249 9:34095494-34095516 ACTGGAGGGTAGCAGTGCTGAGG - Intronic
1053547140 9:39035011-39035033 TTTGTTTGATAGCATTGCTATGG + Intergenic
1053811456 9:41856679-41856701 TTTGTTTGATAGCATTGCTATGG + Intergenic
1054275182 9:63061241-63061263 TCTGTTGAATAAAAGTGATGAGG + Intergenic
1054399649 9:64703699-64703721 TCTGTTGAATAAAAGTGATGAGG - Intergenic
1054433232 9:65187960-65187982 TCTGTTGAATAAAAGTGATGAGG - Intergenic
1054497151 9:65833709-65833731 TCTGTTGAATAAAAGTGATGAGG + Intergenic
1054619138 9:67330760-67330782 TTTGTTTGATAGCATTGCTATGG - Intergenic
1055467326 9:76578561-76578583 TCTGTTGGACAGCGCTGCTCCGG + Intergenic
1055843656 9:80535112-80535134 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1057784873 9:98079635-98079657 TCTGTGGGATGGGAGTGCAGGGG - Intronic
1058403232 9:104641311-104641333 TATGTTGAATAGGAGTGGTGAGG - Intergenic
1059728038 9:117028397-117028419 TTTGCTGGGTAGCAGCGCTGGGG + Intronic
1060450046 9:123729219-123729241 TGTGTTGAATAGGAGTGGTGAGG - Intronic
1061545048 9:131299571-131299593 TCTGTTGGAGAGCTGCCCTGTGG + Intronic
1062151400 9:135021080-135021102 TCTGCAGGATAACAGGGCTGAGG - Intergenic
1203452170 Un_GL000219v1:128933-128955 TATGTTGAATAGGAGTGATGAGG - Intergenic
1203459681 Un_GL000220v1:22595-22617 TATCTTGAATAGGAGTGCTGAGG + Intergenic
1185705611 X:2264243-2264265 TCTGCTGGGTAGCGGTGCTCTGG - Intronic
1187425024 X:19169880-19169902 TCTGCTGGACAGCACTGCTGTGG + Intergenic
1189039384 X:37526486-37526508 TATGTTGAATAGGAGTGGTGAGG + Intronic
1189460041 X:41233554-41233576 TCTGTTGGATCCCAGTGACGTGG + Exonic
1190169450 X:48100288-48100310 TATGGTGGAGAGCAGAGCTGTGG + Intergenic
1190922347 X:54866338-54866360 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1191020568 X:55855916-55855938 TATGTTGAATAGGAGTGATGAGG + Intergenic
1191163636 X:57363598-57363620 TATGTTGAATAGGAGTGATGAGG + Intronic
1192399435 X:70819542-70819564 TATGTTGAATAGAAGTGTTGAGG - Intronic
1192971652 X:76237772-76237794 TATGTTGAATAGGAGTGGTGTGG - Intergenic
1194323982 X:92487973-92487995 TCTGTTGCCCAGCAGTGCAGTGG + Intronic
1194613928 X:96078231-96078253 TATGTTGAATAGGAGTGGTGAGG + Intergenic
1194772219 X:97919632-97919654 TATGTTGAATAGAAGTGGTGAGG - Intergenic
1195142331 X:101974597-101974619 TATGTTGAATAGGAGTACTGAGG + Intergenic
1197930636 X:131691179-131691201 TTTGTTGCATACCATTGCTGGGG + Intergenic
1198094964 X:133370786-133370808 TCTTTTGGTTAGCAGTTCTATGG - Intronic
1199162980 X:144636082-144636104 TCTTTTGGGTAGCAGTGATTTGG - Intergenic
1199587731 X:149433979-149434001 TATGTTGGTCAGCAGTACTGTGG - Intergenic
1200300874 X:154974193-154974215 TGTGTTGAATAGAAGTGGTGAGG + Intronic
1200388112 X:155914395-155914417 TATGTTGAATAGGAGTGGTGAGG + Intronic
1200632085 Y:5601065-5601087 TCTGTTGCCCAGCAGTGCAGTGG + Intronic
1201111560 Y:10803150-10803172 TTTGGTGGATCGCAGTGCAGTGG - Intergenic