ID: 1100313750

View in Genome Browser
Species Human (GRCh38)
Location 12:93423553-93423575
Sequence CAGCCTGGTGTACCTAGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100313747_1100313750 27 Left 1100313747 12:93423503-93423525 CCTTTTAGAGGAGGAGCTAATTT 0: 1
1: 0
2: 2
3: 6
4: 164
Right 1100313750 12:93423553-93423575 CAGCCTGGTGTACCTAGCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100313750 Original CRISPR CAGCCTGGTGTACCTAGCGT GGG Intronic
902574701 1:17370119-17370141 CACCCAGGTGTACCCAGCATAGG - Intergenic
904237262 1:29123605-29123627 CTCCCTGGTGTCCCCAGCGTCGG - Intronic
909241425 1:73218926-73218948 CAGCTTGGTATATCTAGCTTGGG - Intergenic
914806242 1:150994255-150994277 CTTCCTGGTGTACCTATCTTTGG + Intronic
922615510 1:226958889-226958911 GAGACTGGTGTTCCTAGCGAGGG + Intronic
1067719796 10:48719720-48719742 CAGCCTGCTGCATCTGGCGTCGG - Intronic
1071298578 10:84240225-84240247 CAGCCTGCTGTTCCCAGCCTGGG - Intronic
1071678557 10:87681184-87681206 AACCCTGCTGTACATAGCGTTGG + Intronic
1074392949 10:113073069-113073091 CAGCCATGTGTACCTAGGGCAGG + Intronic
1076769478 10:132655241-132655263 CAGCCTGGTGTCCCTACCCCTGG + Intronic
1076871920 10:133198664-133198686 CAGGCTGGGGGACCCAGCGTGGG - Exonic
1077441182 11:2570004-2570026 GAGCCTGGTGTACCTGCGGTAGG - Intronic
1089180945 11:116582454-116582476 AAGCCTGGCGTCCCTGGCGTTGG - Intergenic
1092643482 12:10542900-10542922 CAGCTTGGTGTGCCTAGTGCCGG - Intergenic
1100313750 12:93423553-93423575 CAGCCTGGTGTACCTAGCGTGGG + Intronic
1103822564 12:123710757-123710779 CAGCCTAGTGTAACTAGCTTTGG + Intergenic
1118873023 14:69759142-69759164 CAGGCTGGTTCACCTTGCGTTGG - Intronic
1125915123 15:43479881-43479903 CAGCCTGGTATAACCAGAGTTGG + Exonic
1134244912 16:12532813-12532835 CAGCCTGGTCAGCCTAGCGAGGG + Intronic
1150729533 17:67680056-67680078 CAGCCTGGAGTCCCTAGAGCAGG + Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1153782141 18:8504318-8504340 CAGCCTGGTCTAACTGGCTTTGG + Intergenic
1166202758 19:41249114-41249136 CTGCCTGGTGTCCCTAGCTGTGG - Intronic
1166865655 19:45835198-45835220 CAGCATGGTGTACCTACCCGAGG - Exonic
1167947209 19:52997712-52997734 CAGCCTGGGGTAGCTGGGGTAGG - Intergenic
927687196 2:25179211-25179233 CAGCCTGGTGTCCCTCTCCTGGG - Intergenic
927750089 2:25660950-25660972 AAGCCTGGTGGATCTAGTGTTGG - Intronic
944857223 2:203779615-203779637 CAGCCTGGTGTGTCTGGAGTTGG + Intergenic
949012690 2:241690267-241690289 CAGCATGGTGTACCTCTCTTAGG + Intergenic
1170972335 20:21127427-21127449 CAGCCAGGTGTTCCTAGCACAGG - Intronic
1175309731 20:58003480-58003502 CAGCCTGGGGTGTCCAGCGTGGG - Intergenic
1176151864 20:63595593-63595615 CAGCCCTGTGCACCTACCGTCGG + Exonic
1179491061 21:41741854-41741876 CAGCCTGCTGCACCTGGCGGTGG - Exonic
952764560 3:36943747-36943769 AAGCCTTGTGTTCCCAGCGTAGG - Intronic
953831243 3:46299155-46299177 CTGGCTGGTGTTCCTAGCATAGG - Intergenic
954516905 3:51186674-51186696 CAGCCTAGGGCACCTAGCCTTGG + Intronic
958058309 3:88443058-88443080 CAGACTGGGGTACCTAAGGTAGG - Intergenic
968851841 4:3086059-3086081 CAGCCTGGTATATATAGAGTAGG + Intronic
968980847 4:3848631-3848653 CAGCCAGGTGTGCCTACCCTGGG - Intergenic
973294119 4:48496549-48496571 CAGACTGTTTTACCTAGGGTGGG + Intergenic
975874263 4:78817547-78817569 CAGAGTGGTGTACCTAGCATGGG - Intronic
985151847 4:186955264-186955286 GACCCAGGTGTACCCAGCGTTGG + Intergenic
985638814 5:1053524-1053546 CAGCCTCGTGTCCGGAGCGTGGG - Intronic
985784377 5:1886394-1886416 CAGCCGGGTGTCCCGAGCGGTGG - Intronic
995260535 5:110098790-110098812 GTGCCTTGTGTACCTAGCCTTGG + Intergenic
1001773327 5:174311670-174311692 CAGCCCGGTGTAGCCAGCATGGG + Intergenic
1002283327 5:178146133-178146155 CAGCCTGGTGTACCTGCGGCTGG + Exonic
1011351039 6:86424053-86424075 TAGCCTGGTGAACCTAGGGAGGG + Intergenic
1050127145 9:2368564-2368586 CAGCCTGGTGAGCCTACCCTTGG + Intergenic
1055998256 9:82185620-82185642 TAGCCTGGTGTACCATGGGTTGG - Intergenic
1190109031 X:47578100-47578122 CAGCCAGGTGCCCATAGCGTGGG + Intronic