ID: 1100322287

View in Genome Browser
Species Human (GRCh38)
Location 12:93507272-93507294
Sequence CTGAATGCATAACTGGAACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100322287_1100322291 13 Left 1100322287 12:93507272-93507294 CCTTGTTCCAGTTATGCATTCAG 0: 1
1: 0
2: 0
3: 14
4: 188
Right 1100322291 12:93507308-93507330 TATTTTCTGATTACATTTGCAGG 0: 1
1: 0
2: 3
3: 42
4: 399
1100322287_1100322292 14 Left 1100322287 12:93507272-93507294 CCTTGTTCCAGTTATGCATTCAG 0: 1
1: 0
2: 0
3: 14
4: 188
Right 1100322292 12:93507309-93507331 ATTTTCTGATTACATTTGCAGGG 0: 1
1: 0
2: 3
3: 41
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100322287 Original CRISPR CTGAATGCATAACTGGAACA AGG (reversed) Exonic
901063063 1:6482338-6482360 CTTAATTCATAAATGAAACAAGG - Intronic
901479430 1:9514599-9514621 CTGATTGCAGAACTGGGGCAGGG + Intergenic
905937718 1:41838003-41838025 CTGAAAGGAGAGCTGGAACATGG - Intronic
907930684 1:58996896-58996918 CTGAAAGCACAACTGATACAGGG + Intergenic
911140884 1:94501341-94501363 CTGCATATATAACTGGAGCATGG + Intronic
913439447 1:118882408-118882430 TTGAATGCATCACTGCAGCATGG - Intergenic
917442553 1:175080140-175080162 CTGCAGGCAGAACAGGAACAGGG - Intronic
917452907 1:175162014-175162036 CTGAGTTCAGAACAGGAACAGGG - Intronic
918923874 1:190753476-190753498 TTGAGGGCACAACTGGAACAGGG + Intergenic
920967372 1:210712180-210712202 CAGAATCCATAAAAGGAACATGG + Intronic
921085396 1:211786475-211786497 CAGAATGGATAACTGAAATATGG - Intronic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
923565190 1:235071138-235071160 CTGAATCCATTTCTGGGACATGG + Intergenic
1063363754 10:5477454-5477476 CTAAATTCAGATCTGGAACACGG - Intergenic
1063500447 10:6548966-6548988 ATGAATGGATAAATGGATCATGG - Intronic
1064634664 10:17351665-17351687 CTGAATGCATAAATGAAATGTGG + Intronic
1066134109 10:32426125-32426147 TTGACTTCATATCTGGAACATGG - Intergenic
1066169818 10:32829314-32829336 CAGAATGCATAAGTAGAAGAAGG + Intronic
1066663374 10:37758359-37758381 CTGATTGCAGGACTGGGACAAGG - Intergenic
1069060751 10:63892087-63892109 GTGAATACAGAACTGAAACAAGG - Intergenic
1070532900 10:77353004-77353026 CTGAATGCAAAATTAGAACTTGG + Intronic
1071200441 10:83216069-83216091 CTGAATGAATAAATAGTACAAGG + Intergenic
1072935694 10:99711029-99711051 GTGAATGCATGAATGGAAAATGG - Intronic
1073379359 10:103066195-103066217 CTGAAACCATAACAGGACCATGG - Intronic
1073491960 10:103858518-103858540 GTGAATGGAGAACTGGAACCAGG - Intergenic
1074567465 10:114593827-114593849 TTGAATTCCAAACTGGAACAGGG - Intronic
1079056407 11:17209808-17209830 ATGAATTCAGAACTGCAACAAGG - Intronic
1083669809 11:64293278-64293300 CTGAAAGCAGCACTGGCACAGGG - Intronic
1084793758 11:71490928-71490950 CTGGATGCAGAACTGGACGAAGG - Exonic
1085303558 11:75472721-75472743 CTGAATGAACAACTGGAAGGAGG - Intronic
1085564574 11:77501543-77501565 TTGTATGGATCACTGGAACAGGG - Intergenic
1089826796 11:121284943-121284965 CTGAATGCAAAGATGGAACGAGG + Intergenic
1090931074 11:131298674-131298696 CATCATGCATAACTGGTACAAGG + Intergenic
1093348754 12:18071065-18071087 CTGAATGCGAAGATGGAACAAGG + Intergenic
1093536413 12:20228996-20229018 TTGACTGAATAACTGGAACAAGG - Intergenic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1098430991 12:70420134-70420156 CTGAATGACTAACTGGGAAAGGG + Intronic
1100322287 12:93507272-93507294 CTGAATGCATAACTGGAACAAGG - Exonic
1101396204 12:104350503-104350525 GTGAATGCATAATCTGAACATGG - Intergenic
1102542371 12:113631140-113631162 CTGAAGGCATAACTGCAACTAGG - Intergenic
1102817358 12:115878015-115878037 CTGAATGAATAAATGTAACTTGG - Intergenic
1104605197 12:130183029-130183051 CTAAATCCATAACTGGAGAAAGG + Intergenic
1109164422 13:59015943-59015965 ATTAATGCAAATCTGGAACATGG + Intergenic
1110357964 13:74590312-74590334 CTGAATGCATAAATGAAAAAAGG + Intergenic
1110795654 13:79634471-79634493 TTGAATGCATGACTGGGCCAGGG + Intergenic
1113450601 13:110406924-110406946 CTGAAGGCATAAGGGGAACAAGG - Intronic
1113576690 13:111399984-111400006 CTGTCTGCAGAACTGGACCAGGG + Intergenic
1114140778 14:19907960-19907982 GTGAATGCATAACATGAATAGGG - Intergenic
1114738684 14:25070538-25070560 TTGACTGAATAACTGGAAAAAGG + Intergenic
1116106290 14:40512325-40512347 TTGAAAGCATAATTGAAACAAGG - Intergenic
1120071339 14:80107020-80107042 CTAAATGGAAAACAGGAACAGGG - Intergenic
1120461120 14:84796878-84796900 CTGAAGGCAAAACTGAATCAAGG - Intergenic
1123436170 15:20256202-20256224 TTGAATGCATCACTTGACCAAGG + Intergenic
1124503024 15:30246687-30246709 CTGAATGCATTACTATGACAGGG + Intergenic
1124740532 15:32291959-32291981 CTGAATGCATTACTATGACAGGG - Intergenic
1125101094 15:35913629-35913651 CTGAATGAATAAATGGTAGATGG - Intergenic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1128602913 15:69012807-69012829 TTGAAAGCAGAACTGGAGCAGGG - Intronic
1130769589 15:86911215-86911237 CTGCATGCAGGACTGGAACTGGG + Intronic
1131953000 15:97701992-97702014 TTGAAAGCATAAATGGACCAGGG + Intergenic
1131953140 15:97703486-97703508 CGGAATGCAAAACAAGAACAAGG + Intergenic
1133096608 16:3451293-3451315 CTGAATGGATACCAGGAAAATGG + Intronic
1133895175 16:9920376-9920398 CTGAATGCAGGACTGGGAGAGGG - Intronic
1134295133 16:12938949-12938971 CTCAATGCTTACTTGGAACATGG - Intronic
1139379298 16:66520431-66520453 CTGAACGCATTGCTGGAACTAGG - Intronic
1140136856 16:72213949-72213971 TTGAATATATAACTGAAACAAGG + Intergenic
1141567967 16:84916051-84916073 CTCAAGGCATAATTGGATCAGGG - Intronic
1142327531 16:89425961-89425983 ATGAATGCAGAACGAGAACAAGG + Intronic
1142889975 17:2936927-2936949 CTGAATGAATAACTGAAGAAAGG - Intronic
1143660235 17:8320078-8320100 TTGAATGAATAAATGAAACACGG - Intronic
1144125961 17:12203199-12203221 GTGAATGCTTAACAGGTACAGGG - Intergenic
1144747317 17:17624451-17624473 CTGAATGAATCACTTGAACCTGG + Intergenic
1150624589 17:66833612-66833634 CTGAATGAATGACTGGAAGTTGG - Intergenic
1151112434 17:71694605-71694627 CTCAATGCCTAACTGGATCAAGG + Intergenic
1153971420 18:10230410-10230432 CAGAATGGATAACTGGAATGGGG + Intergenic
1155127377 18:22891701-22891723 TTGACTGCATAACTGGACAAAGG - Intronic
1155453145 18:25983875-25983897 CTGAATGGGTAGCAGGAACAAGG + Intergenic
1155509433 18:26562139-26562161 CTGTATCCATAACTGAAACCTGG + Intronic
1157790704 18:50528569-50528591 CTGAATAGAGAACTAGAACATGG - Intergenic
1159090021 18:63837552-63837574 CTGAATGTATAACTGTACCTGGG + Intergenic
1159604958 18:70465787-70465809 CTGACTGGAGACCTGGAACAAGG + Intergenic
1159892069 18:73962343-73962365 TTGACTGAATAACTGGAAGAAGG + Intergenic
926540401 2:14171319-14171341 CTGAATGCTTAAGTGGAAAGTGG - Intergenic
926613945 2:14976131-14976153 ATGAAGTAATAACTGGAACACGG + Intergenic
926620025 2:15039271-15039293 CTGAATGAATGAGTGGAAAATGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929958479 2:46478704-46478726 CTGAGGGCCTAAATGGAACAAGG + Intronic
930084474 2:47484809-47484831 ATGAATGCATAAATGAAACGTGG + Intronic
930361112 2:50381120-50381142 CAGAATGAATGAATGGAACATGG + Intronic
932549177 2:72749837-72749859 CTACATGCATAAGTGGATCATGG - Intronic
933526619 2:83448656-83448678 ATGAATGCATAAGTGACACATGG - Intergenic
933591651 2:84239625-84239647 CTGAAAGCATAAGAGGAAAAAGG + Intergenic
935305368 2:101731830-101731852 GTGAATGAAAAACAGGAACAGGG - Intronic
936350057 2:111705782-111705804 CTGAATACCTAACTGGAATAAGG - Intergenic
938183135 2:129202686-129202708 CTGATTTGATAACTGGAGCAGGG + Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939548228 2:143580564-143580586 CTGAATTCATCACAGGAACTTGG - Intronic
939894869 2:147779284-147779306 CTAAATACATAATTGGAACGTGG - Intergenic
940862663 2:158786921-158786943 ATGAATGTATTACTGAAACAGGG + Intergenic
942816686 2:180060711-180060733 CTGAATGCGAAGATGGAACAAGG + Intergenic
945838954 2:214865890-214865912 CTGATTGAATAACTGGGAGAAGG - Intergenic
946584342 2:221167653-221167675 CAGAATGCTTAACTGACACATGG - Intergenic
946746281 2:222848935-222848957 CAGAATCCATAAATGTAACAAGG - Intergenic
947624075 2:231608485-231608507 CTGAATGGATGACTGTTACAGGG - Intergenic
948032374 2:234829369-234829391 CTGAATGAATAAGTGGATCTTGG - Intergenic
1170436132 20:16331106-16331128 CTGAATGCATAGCTGGACCCAGG + Intronic
1170646434 20:18200165-18200187 CTGAATGCAACACTGGATCTTGG - Intergenic
1173157918 20:40630741-40630763 CTGCATGCTTATCTGGATCAAGG + Intergenic
1173896876 20:46557845-46557867 TTGAATGAATAAATGGAAGAAGG + Exonic
1174419604 20:50391037-50391059 CTGAAGGCAGAGCTGGAACTGGG + Intergenic
1176047174 20:63098894-63098916 GTGAATGCATGGATGGAACATGG + Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1179210211 21:39318199-39318221 ATGAATGCATATCTAGAAAATGG + Intronic
1181683507 22:24512902-24512924 GTGAATGGATAAATGAAACATGG - Intronic
1182408084 22:30155533-30155555 CTGATTCCAGGACTGGAACAGGG - Intronic
1182865380 22:33599822-33599844 CTGAATGCAACTGTGGAACACGG + Intronic
1184564234 22:45282353-45282375 CTGAATCCAGAGCTGGGACAGGG + Intergenic
949142250 3:648857-648879 CTGAATTCAAAAGTGGAAAAAGG + Intergenic
949403952 3:3695345-3695367 CTGAATGGTTTCCTGGAACATGG - Intergenic
952277979 3:31895926-31895948 CTGAGTGCATTGCTGAAACAGGG - Intronic
953762858 3:45705817-45705839 TTCAATGCATCAGTGGAACAGGG + Intronic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
955515672 3:59724202-59724224 CTGAAGGCATAACTGGAAAGTGG - Intergenic
955872863 3:63458027-63458049 CTGAATGAATAACTGGGATTAGG - Intronic
957041427 3:75338378-75338400 CTGAGTGCATAACTGGTAATTGG - Intergenic
958984245 3:100761948-100761970 CTGTTTGAATAACTGGAAGATGG - Intronic
960428565 3:117539970-117539992 CTGTAAGCCTAACAGGAACAAGG - Intergenic
961392267 3:126559148-126559170 CTGTATGCAGAACCTGAACAGGG - Intergenic
962553258 3:136518125-136518147 TTGAATTCATAACAGGAAAATGG + Intronic
963676003 3:148312545-148312567 CTTTATTAATAACTGGAACATGG - Intergenic
964634081 3:158841963-158841985 ATGAATACATCACAGGAACAAGG - Intergenic
965367160 3:167815070-167815092 CTGAGTGCATACCTGGTACCCGG + Intronic
967816802 3:193806282-193806304 CTTAGTTCATAACTGGACCATGG + Intergenic
971333772 4:25704053-25704075 CTAGATGCATATTTGGAACAAGG - Intergenic
971928896 4:33052428-33052450 CTGATTGCAAAACTGGAAGCTGG + Intergenic
974092323 4:57324347-57324369 GTGAATGAATAAATGGAACCAGG + Intergenic
975846884 4:78534485-78534507 GTGAATACACAACTGGCACAGGG - Intronic
978593550 4:110352471-110352493 CTGAATGCCAAACTGGAGTAGGG + Intergenic
978814148 4:112883732-112883754 CTGATTGCATGACTGCAATATGG - Intronic
979987976 4:127338885-127338907 CTGAACCCATCACTGGAAAAAGG + Intergenic
979991108 4:127376602-127376624 GTGAATGGATAAGTGAAACATGG + Intergenic
988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG + Intergenic
988149147 5:27353571-27353593 AGGAATGCAAAAATGGAACAGGG + Intergenic
988407837 5:30847101-30847123 GTAAATGCAAAACTGGAACTTGG - Intergenic
989118883 5:37983576-37983598 CTGAATTCCTAAAAGGAACAGGG - Intergenic
995888090 5:116918593-116918615 GTGTATGAATAACTGGAATATGG - Intergenic
996129203 5:119760714-119760736 TTAACTGCATAATTGGAACATGG + Intergenic
999320104 5:150609157-150609179 CTGAATGCAGAGCTGGGAAAGGG + Intronic
999405812 5:151305716-151305738 ATAAATGCATAAGTGCAACAGGG - Intergenic
1002364275 5:178697906-178697928 TTGATTGAATAACTGCAACAGGG + Intergenic
1003998097 6:11564118-11564140 CTGAATGGATAAATAAAACATGG - Intronic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1012751614 6:103170419-103170441 ATGAATGCATTAATGAAACAAGG - Intergenic
1016133786 6:140512126-140512148 CTAAAAGAATAACTGAAACAGGG - Intergenic
1016214991 6:141588519-141588541 CTGAATGAGTGACTGAAACATGG + Intergenic
1017195433 6:151695176-151695198 TTGAATGCATACCTGGAGCTTGG + Intronic
1017284217 6:152655743-152655765 TTGATTCCATAACTTGAACATGG - Intergenic
1018097898 6:160408508-160408530 CTGGGTGCATAAGAGGAACATGG + Intronic
1018305218 6:162447884-162447906 CAGAATCAATCACTGGAACAAGG - Intronic
1018549809 6:164982993-164983015 CTGGATGGAACACTGGAACAGGG - Intergenic
1018646300 6:165951822-165951844 TTGAATGAATAAATGGAAGAAGG - Intronic
1020873385 7:13662962-13662984 CTGAATGCATAAATTTCACAGGG + Intergenic
1021212976 7:17879061-17879083 CAGAATGCATAACTGGAGACAGG - Intronic
1022267054 7:28767220-28767242 ATAAATGCATACATGGAACAGGG - Intronic
1023022736 7:36025144-36025166 CTGAATGGATAAATTGAATATGG - Intergenic
1023074842 7:36472536-36472558 CTGAGGGCATAACTAGATCAAGG - Intergenic
1025704923 7:63854572-63854594 TTGCATGCATAATTGGAACCAGG - Intergenic
1027458955 7:78428402-78428424 GTCAATTCATCACTGGAACAAGG - Intronic
1030844673 7:114394148-114394170 TTGATTGCATAACTGGGACAGGG + Intronic
1032371050 7:131352340-131352362 CAGAGTGCATAATTGGAAAATGG + Intronic
1032395549 7:131586736-131586758 CTGAATGAATAAATGGTAAAAGG - Intergenic
1032896887 7:136261354-136261376 CTGAATGCAAAGATGGAACGAGG - Intergenic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1037087812 8:14874834-14874856 TTGAATGGATAACTGGAGGAAGG - Intronic
1037522761 8:19696432-19696454 TTTAATACATAATTGGAACAGGG + Intronic
1037681474 8:21101094-21101116 CTGAACCCCTAAGTGGAACATGG - Intergenic
1039041264 8:33410854-33410876 CTGAAAGCAGAACTGGTACACGG + Intronic
1039229811 8:35431265-35431287 CTGAATGAATAACTGAGTCATGG - Intronic
1039716120 8:40110771-40110793 CTGAATACAAAACTGCTACATGG + Intergenic
1039818957 8:41119374-41119396 CTGAATGCACAGCAAGAACAAGG + Intergenic
1040891874 8:52325517-52325539 CTGAAAGCTTAATTAGAACAAGG + Intronic
1041017113 8:53601722-53601744 GTGAAGGCATACCTGGAAGAGGG - Intergenic
1041702794 8:60810215-60810237 CTGACTCCATAACTAAAACAGGG - Intronic
1043962648 8:86434742-86434764 CTGAATGCATAGCTGGTACCTGG - Intronic
1044964603 8:97562871-97562893 CTGAATGCATAAAGGAACCAGGG + Intergenic
1048432591 8:134384125-134384147 TTGAGTGCATGACTGGCACATGG + Intergenic
1049629163 8:143642909-143642931 CTGAATGAGTAACTGGAAGAAGG - Intronic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1053306001 9:36985384-36985406 CTGAAAACAGAACTGGAAAAGGG + Intronic
1055605577 9:77967143-77967165 CTGAATGCATCTCAGGAAAAGGG + Intronic
1059312783 9:113400153-113400175 CTGATTGTATCACTGAAACAAGG + Intronic
1059794515 9:117677810-117677832 CTGAGTGTATTATTGGAACATGG - Intergenic
1060837374 9:126766655-126766677 CTGAACGGATAATTGGAAAAGGG + Intergenic
1186501828 X:10057144-10057166 CTGAATGGATAAATAAAACATGG - Intronic
1187075565 X:15930984-15931006 CTTGATCCATAGCTGGAACAAGG - Intergenic
1187142717 X:16609559-16609581 CTGAATGCCTACTTGCAACAGGG - Exonic
1188047081 X:25438195-25438217 CTGGATATATCACTGGAACATGG + Intergenic
1190567154 X:51742796-51742818 CTGGAAGCTTCACTGGAACAAGG + Intergenic
1192086904 X:68108261-68108283 CTGATTGCATGTCTGGAGCAAGG - Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195908065 X:109864880-109864902 CTGAGTGCAGCCCTGGAACAAGG + Intergenic
1195966602 X:110434986-110435008 CTGAGTGCAGCCCTGGAACAAGG - Intronic
1201373804 Y:13294677-13294699 CTTTCTGCATAACTGAAACATGG - Intronic