ID: 1100328828

View in Genome Browser
Species Human (GRCh38)
Location 12:93567085-93567107
Sequence GAGTGCATCCCAGGATCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 2, 1: 0, 2: 2, 3: 9, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100328823_1100328828 10 Left 1100328823 12:93567052-93567074 CCATTGGCTCACCTGGGCCACAC 0: 1
1: 0
2: 9
3: 32
4: 232
Right 1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG 0: 2
1: 0
2: 2
3: 9
4: 176
1100328824_1100328828 -1 Left 1100328824 12:93567063-93567085 CCTGGGCCACACACTCTTCGTTG 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG 0: 2
1: 0
2: 2
3: 9
4: 176
1100328822_1100328828 11 Left 1100328822 12:93567051-93567073 CCCATTGGCTCACCTGGGCCACA 0: 1
1: 0
2: 2
3: 64
4: 207
Right 1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG 0: 2
1: 0
2: 2
3: 9
4: 176
1100328818_1100328828 29 Left 1100328818 12:93567033-93567055 CCAAGAGCTCGAGTCATTCCCAT 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG 0: 2
1: 0
2: 2
3: 9
4: 176
1100328825_1100328828 -7 Left 1100328825 12:93567069-93567091 CCACACACTCTTCGTTGAGTGCA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG 0: 2
1: 0
2: 2
3: 9
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100328828 Original CRISPR GAGTGCATCCCAGGATCACA GGG Intergenic
902535282 1:17116197-17116219 CAGTGCCTGCCAGGACCACAAGG + Intronic
902830253 1:19007897-19007919 GAGAGCATGCCAGGGTCCCAGGG - Intergenic
903016419 1:20365031-20365053 GAGAGCATTCAAGGATGACAGGG + Intergenic
906367393 1:45222565-45222587 GAGTGTATCCCAATATCAAAAGG - Intronic
913276672 1:117144961-117144983 AAGTGCATCCCCAGATCTCAGGG - Exonic
913585358 1:120269850-120269872 AAGTGAATCCCAGGCTCAGAAGG + Intergenic
913622825 1:120628517-120628539 AAGTGAATCCCAGGCTCAGAAGG - Intergenic
914567362 1:148881710-148881732 AAGTGAATCCCAGGCTCAGAAGG + Intronic
914605460 1:149248535-149248557 AAGTGAATCCCAGGCTCAGAAGG - Intergenic
918783136 1:188729803-188729825 TACTGAATCACAGGATCACAAGG + Intergenic
919060269 1:192623160-192623182 CCCTGCATCCCAGGATCCCAGGG + Intergenic
919406334 1:197189260-197189282 AAGTGCTTCCCGGGATTACAGGG - Intronic
921256021 1:213340202-213340224 GAGAGAAGCCCAGCATCACAGGG - Intergenic
922549038 1:226480560-226480582 GAGTGCATCCCAGCTCCAGAAGG - Intergenic
1067270701 10:44789199-44789221 GAGTGCATCCCAGGTTCTGTGGG - Intergenic
1069695569 10:70382882-70382904 CAGTACATCCCAGGATCTCTAGG + Intergenic
1069894845 10:71673943-71673965 GAGCTCATCCCAGGTTCTCAGGG - Intronic
1070245417 10:74726874-74726896 GAGTTTATCCCAGGAATACAGGG + Intergenic
1070553006 10:77505683-77505705 GGTTGCAGCCCAGGAACACAGGG + Intronic
1071236368 10:83654891-83654913 GAGTACACACCAGGCTCACATGG - Intergenic
1074766494 10:116703824-116703846 GAGTGCATCCCAGGAGGCCCAGG + Intronic
1075836980 10:125462329-125462351 GAGTTCATCCCAGGTGCAAAGGG - Intergenic
1079911974 11:26321639-26321661 GACTACATCCCAGAATCACATGG - Intronic
1080689785 11:34546803-34546825 GAGAGCATGCCAGTTTCACAAGG - Intergenic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1081314672 11:41617159-41617181 GAGAGCATCTCAGCATCTCAGGG - Intergenic
1082058602 11:47841613-47841635 GAGCACGTTCCAGGATCACATGG - Intronic
1084573003 11:69970757-69970779 GTGGGCATTCCAGGATCCCAAGG + Intergenic
1084646716 11:70463393-70463415 GAGTGCAGGCCAGGCTCAGAAGG + Intergenic
1085191346 11:74626552-74626574 GAGTTTATCCCAAGAACACAAGG - Intronic
1085729275 11:78982581-78982603 GAATGCATCCCTGGGCCACAGGG - Intronic
1086456299 11:86962036-86962058 GTATGCATCCCAGGCTGACAAGG + Intergenic
1090469686 11:126969250-126969272 GAGTGCCTCCCATGGACACAGGG + Intronic
1094870843 12:34598473-34598495 CAGGGCATCCCAGGATCCCCTGG - Intergenic
1095434037 12:42167945-42167967 GACTGCATCCCAAGATTACTGGG + Intronic
1096329394 12:50697064-50697086 GAAGGCATCACAGGATGACACGG - Exonic
1096332908 12:50730032-50730054 TAGTGTATCCCAGGATAAAAAGG - Intronic
1097058661 12:56266562-56266584 AATTGCCTCACAGGATCACAAGG - Intergenic
1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG + Intergenic
1101215949 12:102583043-102583065 GAGGGCATTCCAGGTTTACAAGG - Intergenic
1102585855 12:113922477-113922499 GAGTGCTCCCCAGGAGTACAAGG + Intronic
1103345096 12:120244097-120244119 GAGAGCAACACAGGAGCACAGGG + Intronic
1107132008 13:36906677-36906699 GAGTGCAAACCAAAATCACAAGG + Intronic
1109406533 13:61907611-61907633 GAGTCCATCCCAGCAACTCAGGG + Intergenic
1113328727 13:109308557-109308579 GACTGCACCTTAGGATCACATGG + Intergenic
1113779929 13:112970590-112970612 GCGTGGATGCCAGGTTCACAGGG + Intronic
1113896189 13:113766006-113766028 TAGTGCATCCCAGGACCCCTGGG + Intronic
1114568321 14:23648338-23648360 GTGGGCATCCCAGGTTCCCAAGG + Intergenic
1116927058 14:50650479-50650501 GTGTGAATCCCAGGAGGACAGGG - Intronic
1119550673 14:75511396-75511418 GAGTGCATTCCAGGAATGCAAGG + Intergenic
1125757908 15:42077396-42077418 GAATTCATCCCAGGAACGCAAGG + Intronic
1127994350 15:64144420-64144442 CAGTGCAGCCCAGGACCCCAGGG - Intronic
1128804466 15:70520398-70520420 GAGTGGATTCCTGGATCATATGG + Intergenic
1130822398 15:87509189-87509211 GAGTGCCTCCCTGGTTCACACGG - Intergenic
1132178455 15:99733531-99733553 GAGCTCATCCCGGGACCACAGGG + Intronic
1132463857 16:68639-68661 CAGTGCATCCCAGGACCAGCTGG + Intronic
1132779939 16:1618021-1618043 CAGTGCGTCCCAGGGTCACGTGG - Intronic
1133637231 16:7679529-7679551 GAGTGAATCTCATGATTACAGGG - Intronic
1134816783 16:17212400-17212422 GACTGCATGTCAGAATCACAGGG - Intronic
1135988908 16:27205049-27205071 GAGAGAATCCTAGGATGACAGGG + Intronic
1136033373 16:27519543-27519565 GAGTTCAGCCCAGTCTCACATGG + Intronic
1137825780 16:51493680-51493702 CAGAGCATCCCAGGGCCACAGGG + Intergenic
1138456606 16:57124774-57124796 GAGGGCATCACAGGATGCCATGG + Intronic
1139487059 16:67263881-67263903 AAGTGCAGCCCAGGATATCATGG + Intronic
1139530704 16:67541397-67541419 GAGTGCATGGTAGGGTCACAAGG - Intronic
1139546422 16:67651987-67652009 GAGTGCAGCCCGGGATCAGCTGG + Exonic
1141021369 16:80499944-80499966 GAGTGCACCCGATGAACACAGGG - Intergenic
1141382863 16:83591434-83591456 GAGTGAATCCCAGGAGCACATGG - Intronic
1141720698 16:85753685-85753707 GACTGCATGCCAGGATCACCTGG + Intergenic
1143118160 17:4592145-4592167 GTTTGCCTCCCAGGATCGCAGGG + Intronic
1143950228 17:10626571-10626593 GAGTGCATGCCAAGTGCACATGG + Intergenic
1145061800 17:19738528-19738550 GGGTGTATCCCAGAACCACAGGG + Intronic
1145127244 17:20311980-20312002 AGGTTCATCCCAGGAACACAAGG - Intronic
1145754869 17:27382926-27382948 GTGTGAATCCCAGGGTCCCATGG - Intergenic
1146641049 17:34541735-34541757 AACAGAATCCCAGGATCACAAGG - Intergenic
1151102549 17:71572509-71572531 GTGTGCAGCCCAGGATGGCAAGG + Intergenic
1154961700 18:21315950-21315972 GTGTGCACCCCAGGCCCACAGGG - Intronic
1156574017 18:38292225-38292247 GAGTGCTTCCCAGACTCATAGGG + Intergenic
1158620216 18:59026447-59026469 CTGTGAATCCCAGGAGCACACGG - Intergenic
1158982766 18:62780837-62780859 GAGGGAATCCAAGGACCACAAGG - Intronic
1161039037 19:2100307-2100329 GAGTGCCTCCCAGGCTCCCTGGG + Intergenic
1162566680 19:11448628-11448650 GAGTGCGTCCCAGGAATGCAGGG + Exonic
1163275627 19:16282477-16282499 GGGTGGAACCCAGAATCACAGGG + Intergenic
1164485421 19:28651751-28651773 AAGTGCTTCCTTGGATCACAGGG + Intergenic
1166415624 19:42593178-42593200 GTGAGGATCCCAGGATCCCAGGG + Intronic
1167369226 19:49071022-49071044 GACTTCCTCCCAGGATCCCAGGG + Intronic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925531471 2:4867806-4867828 CAGTGTAGCCCAGCATCACATGG + Intergenic
925711623 2:6746666-6746688 AAGTGCTGCCCTGGATCACAGGG - Intergenic
926317606 2:11722569-11722591 TTGTGCAGCCCAAGATCACAGGG + Intronic
929374582 2:41269733-41269755 GATTGGCTCACAGGATCACAAGG - Intergenic
930447403 2:51491209-51491231 GAGTGCATTGCAGATTCACAAGG + Intergenic
930709596 2:54537788-54537810 GAGTGAAGCCCAGGAGCAGATGG - Intronic
930753543 2:54954328-54954350 CAGTGCATCCCAGGGTCCCAGGG + Intronic
930917536 2:56712100-56712122 AAATGAATCCCAGGAACACATGG - Intergenic
932682976 2:73842447-73842469 GAGTCCATCCCAGCAGCTCAAGG - Intronic
933118439 2:78503698-78503720 AAATTCATCCCAGGATCAGATGG + Intergenic
933453196 2:82483900-82483922 AATTGCATCTCTGGATCACATGG + Intergenic
933715095 2:85354300-85354322 GAGTGCAGCCCCGGACCCCAGGG + Intronic
935115307 2:100130409-100130431 GAGTGCACCCCATGGGCACAGGG + Intronic
935938950 2:108218388-108218410 CAGTGCATCCAAAAATCACATGG - Intergenic
942439056 2:176013434-176013456 GAGTTTATTCCAGGAACACAAGG - Intergenic
942892495 2:181008357-181008379 AAGTTCTTCCGAGGATCACATGG + Intronic
943378842 2:187117724-187117746 GATTGCAGCACAGGAGCACAGGG - Intergenic
944301377 2:198128541-198128563 GTGGGCATCACAGGATCAGATGG + Intronic
945419940 2:209622408-209622430 GTGTCCTTCCCAGCATCACAAGG - Intronic
1171306630 20:24112565-24112587 GTGTCCATCCCATGCTCACAGGG + Intergenic
1171433245 20:25100207-25100229 AAGTGCATCCCCAGATCTCAGGG + Intergenic
1174521156 20:51131789-51131811 GACAGCATCACAGCATCACAGGG + Intergenic
1174832654 20:53827199-53827221 CAGGGCATCACATGATCACATGG + Intergenic
1176913954 21:14602747-14602769 GAGTGCAACCCAACATCACCTGG + Intronic
1177226987 21:18270002-18270024 GAGTGTATGCCAGGGTCTCAAGG - Exonic
1177251149 21:18592719-18592741 GAGTGCAACCCAGTAACATAAGG - Intergenic
1177679434 21:24346350-24346372 GATTGCATGCCATGACCACATGG - Intergenic
1180931346 22:19594088-19594110 GAGTGTATCCCAGGAGTAAATGG + Intergenic
1183366397 22:37409329-37409351 TGCTGCATCCCAGGATCACTGGG - Intronic
1184073944 22:42164181-42164203 GAGTGCATCCCAGGGAAAAAAGG - Intronic
954810979 3:53247665-53247687 GAGAGAATCCCAGGATGTCAGGG + Intronic
959420985 3:106128069-106128091 GAGTGCTTCCCAGAATCAAAAGG - Intergenic
960360993 3:116710942-116710964 GAGTGCTTCCCAAGGTCACATGG + Intronic
962221298 3:133566548-133566570 GAGCAGATCCCAGAATCACATGG + Intergenic
962286764 3:134092930-134092952 GGGGGCTTCCCAAGATCACACGG + Intronic
962962925 3:140327998-140328020 GAGGGCATCCCAGAAGCCCATGG + Intronic
966493399 3:180553034-180553056 TAGTGCAACCCAGGTTCACCGGG + Intergenic
971897524 4:32616854-32616876 AATTGGATCCCAGGATGACAAGG + Intergenic
973533745 4:51859851-51859873 GACTGCATTCCATGATCAGACGG - Intronic
979404723 4:120295417-120295439 GATTGCAACCAAGGAGCACAGGG - Intergenic
980121996 4:128737372-128737394 GAGTCCATCCCGGTACCACAAGG + Intergenic
980245392 4:130233066-130233088 AACTGGATCCCAGGCTCACATGG - Intergenic
983788703 4:171766830-171766852 AGGTGCATCGCAGGAACACATGG + Intergenic
985001289 4:185486351-185486373 GAGTTTATCCCAGGGTTACAAGG - Intergenic
985507974 5:295482-295504 GATGGAATCTCAGGATCACAAGG + Intronic
985593212 5:775948-775970 GAGTGCATGCCAGGAACCCCTGG + Intergenic
985740061 5:1610186-1610208 GATGGAATCTCAGGATCACAAGG - Intergenic
986496177 5:8344214-8344236 GAGCCCATCCCAGCATAACATGG - Intergenic
986741359 5:10708495-10708517 TAGTGCATCCCAGGATACAAGGG - Intronic
986897152 5:12384724-12384746 GAGTTCTTCCCAGGAAAACATGG + Intergenic
995048565 5:107675302-107675324 GAGTGCACCCCAGGATAGAAGGG - Intergenic
998484052 5:142486401-142486423 GAGTGCAAACCATGATCCCAGGG - Intergenic
998747607 5:145278708-145278730 GGGTCCATCCAAGGAACACAAGG + Intergenic
1001749755 5:174119675-174119697 CAGGGCACCCCAGAATCACATGG - Intronic
1002167666 5:177358348-177358370 GGCTGCATCCCAGGGTCTCAGGG + Intronic
1003416135 6:5909978-5910000 GAGAGAATCCCAGGAGCAGATGG + Intergenic
1006949418 6:37809200-37809222 GAGTCCATCCCAGCCACACATGG + Intergenic
1011714739 6:90093342-90093364 GAGTGCACATCAGGGTCACATGG + Intronic
1014336143 6:120139989-120140011 GAGGGCATCACATGATGACAGGG + Intergenic
1017066324 6:150532627-150532649 GAGTGCAAACCAAGATCTCATGG - Intergenic
1018153863 6:160966625-160966647 GAGAGCTTCCTATGATCACAAGG - Intergenic
1020875808 7:13692094-13692116 AAGTGACTCACAGGATCACAAGG - Intergenic
1022397995 7:30008138-30008160 TAGTGCATGGCAGAATCACATGG - Intergenic
1024419549 7:49147603-49147625 GATTTCATGCCAGGAACACAGGG + Intergenic
1028382974 7:90219617-90219639 GAATGCATCCCAGGGATACAAGG - Intronic
1031598874 7:123679532-123679554 GAGTTCTTCCAAGGACCACAAGG - Intergenic
1033666670 7:143447113-143447135 GAGTGCTTCTCAGGATATCAGGG - Intergenic
1033980043 7:147152860-147152882 GAGAACAGCCCAGGATTACACGG + Intronic
1034417665 7:150973829-150973851 TAGTGCCTGCCAGGCTCACAAGG + Intronic
1037107610 8:15128609-15128631 TACTGTATTCCAGGATCACAGGG - Intronic
1037428553 8:18784762-18784784 GTGGGCATCCCAACATCACAGGG - Intronic
1041166271 8:55095782-55095804 GAGTCCATCCTAGGAAGACAGGG + Intergenic
1041334072 8:56760093-56760115 GAGTTCATGGCAGGAACACAGGG - Intergenic
1042637168 8:70890631-70890653 GAATTTATCCCAGGAACACAAGG - Intergenic
1042885290 8:73542901-73542923 GAGTGAATTGCTGGATCACATGG - Intronic
1043026939 8:75082099-75082121 GAGTGCATCCCAGGATCACATGG + Intergenic
1045887164 8:107112438-107112460 GAGTCCCTCCCAGGAAAACATGG - Intergenic
1047379465 8:124345287-124345309 GAGTTCCTCCCAGCAACACATGG - Intronic
1047447873 8:124936486-124936508 GAGAGAAGCCAAGGATCACAAGG - Intergenic
1048408308 8:134145358-134145380 GAATCCATCCCAGTGTCACAAGG - Intergenic
1049408295 8:142461338-142461360 GAGTCCATCCCAGGTTCACAGGG - Intronic
1050487341 9:6148121-6148143 GATTGGATTCCAGGATGACAGGG - Intergenic
1051797558 9:20890506-20890528 GAGTGTATCCCAGGAATGCAAGG - Intronic
1053020658 9:34691707-34691729 GAGGCCACCCCAGGATCTCATGG - Intergenic
1054571912 9:66820297-66820319 GAGTTCATCCCAGATTCACTGGG + Intergenic
1056289617 9:85129410-85129432 TTGTGGATCCCAGAATCACAGGG - Intergenic
1056445077 9:86657711-86657733 GAGTGCATTGCTGGATCAAATGG + Intergenic
1057290513 9:93803136-93803158 TGGTGCTTCCCAGCATCACATGG - Intergenic
1057906199 9:98985566-98985588 GACTGCTTCCCAGGGTCACCTGG + Exonic
1058158914 9:101546012-101546034 GTGAGCATCCCAAGATCACCAGG + Intronic
1058655529 9:107217208-107217230 GGGTGCATCTCAGGAACACATGG - Intergenic
1060785726 9:126450470-126450492 GAGTACATCCCTGGTCCACAAGG - Intronic
1187319370 X:18226427-18226449 GGCTGCACCCCAGGATCACCAGG + Intergenic
1190981845 X:55463376-55463398 GAGGGCAGCACTGGATCACAGGG - Intergenic
1190986853 X:55509804-55509826 GAGGGCAGCACTGGATCACAGGG + Intergenic
1195638957 X:107153100-107153122 GAGAGCATTCCAGGAACAGAGGG - Intronic
1197084622 X:122456881-122456903 TATTGCCTCACAGGATCACAAGG + Intergenic
1199635923 X:149811374-149811396 GAGAATGTCCCAGGATCACAAGG + Intergenic
1199800252 X:151243595-151243617 GCCTGCCTCCCAGGATGACAAGG - Intergenic
1200967829 Y:9116992-9117014 GAGTGTATCCCCAGATGACAGGG + Intergenic
1201473855 Y:14360370-14360392 TAGTGCATCACAGGATCTCATGG - Intergenic