ID: 1100331895

View in Genome Browser
Species Human (GRCh38)
Location 12:93590668-93590690
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 744778
Summary {0: 2061, 1: 108024, 2: 251521, 3: 227196, 4: 155976}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100331895_1100331903 26 Left 1100331895 12:93590668-93590690 CCTGTAATCCCAGCTACTCCGGA 0: 2061
1: 108024
2: 251521
3: 227196
4: 155976
Right 1100331903 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG No data
1100331895_1100331901 12 Left 1100331895 12:93590668-93590690 CCTGTAATCCCAGCTACTCCGGA 0: 2061
1: 108024
2: 251521
3: 227196
4: 155976
Right 1100331901 12:93590703-93590725 AAGAATCGCTTGAACCCAGCAGG 0: 35
1: 3046
2: 36287
3: 106344
4: 164093

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100331895 Original CRISPR TCCGGAGTAGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr