ID: 1100331897

View in Genome Browser
Species Human (GRCh38)
Location 12:93590676-93590698
Sequence CCTCAGCCTCCGGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 766741
Summary {0: 4636, 1: 212588, 2: 277873, 3: 178664, 4: 92980}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100331897_1100331901 4 Left 1100331897 12:93590676-93590698 CCCAGCTACTCCGGAGGCTGAGG 0: 4636
1: 212588
2: 277873
3: 178664
4: 92980
Right 1100331901 12:93590703-93590725 AAGAATCGCTTGAACCCAGCAGG 0: 35
1: 3046
2: 36287
3: 106344
4: 164093
1100331897_1100331903 18 Left 1100331897 12:93590676-93590698 CCCAGCTACTCCGGAGGCTGAGG 0: 4636
1: 212588
2: 277873
3: 178664
4: 92980
Right 1100331903 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100331897 Original CRISPR CCTCAGCCTCCGGAGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr