ID: 1100331899

View in Genome Browser
Species Human (GRCh38)
Location 12:93590677-93590699
Sequence GCCTCAGCCTCCGGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 743845
Summary {0: 4367, 1: 193744, 2: 258218, 3: 182337, 4: 105179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100331899_1100331903 17 Left 1100331899 12:93590677-93590699 CCAGCTACTCCGGAGGCTGAGGC 0: 4367
1: 193744
2: 258218
3: 182337
4: 105179
Right 1100331903 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG No data
1100331899_1100331901 3 Left 1100331899 12:93590677-93590699 CCAGCTACTCCGGAGGCTGAGGC 0: 4367
1: 193744
2: 258218
3: 182337
4: 105179
Right 1100331901 12:93590703-93590725 AAGAATCGCTTGAACCCAGCAGG 0: 35
1: 3046
2: 36287
3: 106344
4: 164093

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100331899 Original CRISPR GCCTCAGCCTCCGGAGTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr