ID: 1100331900

View in Genome Browser
Species Human (GRCh38)
Location 12:93590686-93590708
Sequence ATTCTTTCTGCCTCAGCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3780
Summary {0: 2, 1: 4, 2: 54, 3: 478, 4: 3242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100331900_1100331906 29 Left 1100331900 12:93590686-93590708 CCGGAGGCTGAGGCAGAAAGAAT 0: 2
1: 4
2: 54
3: 478
4: 3242
Right 1100331906 12:93590738-93590760 GGCGCCACTGCACTCCAGCCTGG 0: 5047
1: 62314
2: 191429
3: 242516
4: 178772
1100331900_1100331907 30 Left 1100331900 12:93590686-93590708 CCGGAGGCTGAGGCAGAAAGAAT 0: 2
1: 4
2: 54
3: 478
4: 3242
Right 1100331907 12:93590739-93590761 GCGCCACTGCACTCCAGCCTGGG 0: 47841
1: 174825
2: 232776
3: 176871
4: 95097
1100331900_1100331901 -6 Left 1100331900 12:93590686-93590708 CCGGAGGCTGAGGCAGAAAGAAT 0: 2
1: 4
2: 54
3: 478
4: 3242
Right 1100331901 12:93590703-93590725 AAGAATCGCTTGAACCCAGCAGG 0: 35
1: 3046
2: 36287
3: 106344
4: 164093
1100331900_1100331903 8 Left 1100331900 12:93590686-93590708 CCGGAGGCTGAGGCAGAAAGAAT 0: 2
1: 4
2: 54
3: 478
4: 3242
Right 1100331903 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100331900 Original CRISPR ATTCTTTCTGCCTCAGCCTC CGG (reversed) Intergenic
Too many off-targets to display for this crispr