ID: 1100331901

View in Genome Browser
Species Human (GRCh38)
Location 12:93590703-93590725
Sequence AAGAATCGCTTGAACCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309805
Summary {0: 35, 1: 3046, 2: 36287, 3: 106344, 4: 164093}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100331895_1100331901 12 Left 1100331895 12:93590668-93590690 CCTGTAATCCCAGCTACTCCGGA 0: 2061
1: 108024
2: 251521
3: 227196
4: 155976
Right 1100331901 12:93590703-93590725 AAGAATCGCTTGAACCCAGCAGG 0: 35
1: 3046
2: 36287
3: 106344
4: 164093
1100331900_1100331901 -6 Left 1100331900 12:93590686-93590708 CCGGAGGCTGAGGCAGAAAGAAT 0: 2
1: 4
2: 54
3: 478
4: 3242
Right 1100331901 12:93590703-93590725 AAGAATCGCTTGAACCCAGCAGG 0: 35
1: 3046
2: 36287
3: 106344
4: 164093
1100331899_1100331901 3 Left 1100331899 12:93590677-93590699 CCAGCTACTCCGGAGGCTGAGGC 0: 4367
1: 193744
2: 258218
3: 182337
4: 105179
Right 1100331901 12:93590703-93590725 AAGAATCGCTTGAACCCAGCAGG 0: 35
1: 3046
2: 36287
3: 106344
4: 164093
1100331897_1100331901 4 Left 1100331897 12:93590676-93590698 CCCAGCTACTCCGGAGGCTGAGG 0: 4636
1: 212588
2: 277873
3: 178664
4: 92980
Right 1100331901 12:93590703-93590725 AAGAATCGCTTGAACCCAGCAGG 0: 35
1: 3046
2: 36287
3: 106344
4: 164093

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100331901 Original CRISPR AAGAATCGCTTGAACCCAGC AGG Intergenic
Too many off-targets to display for this crispr