ID: 1100331906

View in Genome Browser
Species Human (GRCh38)
Location 12:93590738-93590760
Sequence GGCGCCACTGCACTCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 680078
Summary {0: 5047, 1: 62314, 2: 191429, 3: 242516, 4: 178772}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100331900_1100331906 29 Left 1100331900 12:93590686-93590708 CCGGAGGCTGAGGCAGAAAGAAT 0: 2
1: 4
2: 54
3: 478
4: 3242
Right 1100331906 12:93590738-93590760 GGCGCCACTGCACTCCAGCCTGG 0: 5047
1: 62314
2: 191429
3: 242516
4: 178772
1100331904_1100331906 -3 Left 1100331904 12:93590718-93590740 CCAGCAGGCAGAGCCGAGATGGC No data
Right 1100331906 12:93590738-93590760 GGCGCCACTGCACTCCAGCCTGG 0: 5047
1: 62314
2: 191429
3: 242516
4: 178772
1100331902_1100331906 -2 Left 1100331902 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG No data
Right 1100331906 12:93590738-93590760 GGCGCCACTGCACTCCAGCCTGG 0: 5047
1: 62314
2: 191429
3: 242516
4: 178772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100331906 Original CRISPR GGCGCCACTGCACTCCAGCC TGG Intergenic
Too many off-targets to display for this crispr