ID: 1100331907

View in Genome Browser
Species Human (GRCh38)
Location 12:93590739-93590761
Sequence GCGCCACTGCACTCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 727410
Summary {0: 47841, 1: 174825, 2: 232776, 3: 176871, 4: 95097}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100331902_1100331907 -1 Left 1100331902 12:93590717-93590739 CCCAGCAGGCAGAGCCGAGATGG No data
Right 1100331907 12:93590739-93590761 GCGCCACTGCACTCCAGCCTGGG 0: 47841
1: 174825
2: 232776
3: 176871
4: 95097
1100331904_1100331907 -2 Left 1100331904 12:93590718-93590740 CCAGCAGGCAGAGCCGAGATGGC No data
Right 1100331907 12:93590739-93590761 GCGCCACTGCACTCCAGCCTGGG 0: 47841
1: 174825
2: 232776
3: 176871
4: 95097
1100331900_1100331907 30 Left 1100331900 12:93590686-93590708 CCGGAGGCTGAGGCAGAAAGAAT 0: 2
1: 4
2: 54
3: 478
4: 3242
Right 1100331907 12:93590739-93590761 GCGCCACTGCACTCCAGCCTGGG 0: 47841
1: 174825
2: 232776
3: 176871
4: 95097

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100331907 Original CRISPR GCGCCACTGCACTCCAGCCT GGG Intergenic
Too many off-targets to display for this crispr