ID: 1100339119

View in Genome Browser
Species Human (GRCh38)
Location 12:93661132-93661154
Sequence GTCCCCTGGGACAAAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100339119_1100339124 0 Left 1100339119 12:93661132-93661154 CCTTCACCTTTGTCCCAGGGGAC No data
Right 1100339124 12:93661155-93661177 ATTCTGTTGGCTAAAAGAATAGG No data
1100339119_1100339125 12 Left 1100339119 12:93661132-93661154 CCTTCACCTTTGTCCCAGGGGAC No data
Right 1100339125 12:93661167-93661189 AAAAGAATAGGTCTTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100339119 Original CRISPR GTCCCCTGGGACAAAGGTGA AGG (reversed) Intergenic
No off target data available for this crispr