ID: 1100340392

View in Genome Browser
Species Human (GRCh38)
Location 12:93674062-93674084
Sequence GCACAATTTCAGATTACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100340381_1100340392 26 Left 1100340381 12:93674013-93674035 CCTGTGGATTCGTTACCACTGGG 0: 1
1: 0
2: 0
3: 0
4: 81
Right 1100340392 12:93674062-93674084 GCACAATTTCAGATTACAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 192
1100340384_1100340392 11 Left 1100340384 12:93674028-93674050 CCACTGGGTAACAGGTGCTTAAT 0: 1
1: 1
2: 1
3: 5
4: 100
Right 1100340392 12:93674062-93674084 GCACAATTTCAGATTACAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 192
1100340379_1100340392 30 Left 1100340379 12:93674009-93674031 CCTTCCTGTGGATTCGTTACCAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1100340392 12:93674062-93674084 GCACAATTTCAGATTACAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100340392 Original CRISPR GCACAATTTCAGATTACAGA GGG Intergenic
903327727 1:22580743-22580765 TCACAATTCCATTTTACAGATGG + Intronic
905902715 1:41592316-41592338 GCCCAATTTCATGTTGCAGAAGG - Intronic
908673635 1:66576805-66576827 CCACAACTTCAGATGACACATGG - Intronic
910811737 1:91244661-91244683 TCAAAATTTCAGCTTATAGAAGG - Intergenic
910836129 1:91513272-91513294 GCACAAATTCAGATTAAACAAGG + Exonic
912011096 1:104964151-104964173 GCACAATTCTAATTTACAGAGGG + Intergenic
913179668 1:116309392-116309414 TTTCAATTTCAGATTCCAGAAGG - Intergenic
918720729 1:187849538-187849560 GAACATTTTCAAATTAGAGAGGG + Intergenic
919258974 1:195164806-195164828 TCACTAATTCAGATTAAAGAGGG + Intergenic
920603249 1:207350703-207350725 ACACAATCTCAGATGACAAAGGG - Intronic
920606231 1:207389880-207389902 AACCAATTTCAGGTTACAGAAGG - Intergenic
920627209 1:207613773-207613795 GAATGATTTCAGATTTCAGAAGG + Intronic
920637159 1:207714701-207714723 GAACGATTTTAGATTTCAGAAGG + Intronic
921592454 1:217020587-217020609 GCACAATTACAGAGTTTAGAGGG + Intronic
922295349 1:224245282-224245304 GCACAATATCTAATTTCAGAGGG - Intronic
922353905 1:224758371-224758393 GAACAATTTAAGATTACACTGGG + Intergenic
1063896063 10:10683633-10683655 GCGCAGTTTTAGAGTACAGATGG + Intergenic
1064076768 10:12275174-12275196 GTCCAATTCCAAATTACAGATGG - Intergenic
1066452045 10:35538406-35538428 GCACAATTTCAGATTTCCTTTGG + Intronic
1071306068 10:84299850-84299872 GCACATTTTCATTTTACAGATGG - Intergenic
1078967864 11:16368255-16368277 TTAAAATTTCAGATTAAAGAGGG + Intronic
1080040839 11:27757870-27757892 GCAGAACTTCTGATTAAAGAAGG - Intergenic
1080220968 11:29903387-29903409 GCACATTTTCATATAACAGTTGG - Intergenic
1080490544 11:32758664-32758686 GAAAAATTTCAGATTAGAAAAGG - Intronic
1080601579 11:33825984-33826006 CCACAATTTCAAAATAAAGAAGG - Intergenic
1083029663 11:59580616-59580638 TCACAATTGCAAATTACATATGG + Intronic
1084902959 11:72323674-72323696 GGACCATTCCAGATTAAAGAAGG + Intronic
1086756917 11:90576443-90576465 GCACATTTGCACATTACTGAAGG + Intergenic
1087753497 11:102030528-102030550 ACACAATTTCAAAATAAAGAAGG + Intergenic
1088722948 11:112610697-112610719 TCAAAGTTTCAGAGTACAGATGG + Intergenic
1088925708 11:114299378-114299400 TCACATTTTCAGAATACAGGAGG - Intronic
1090200142 11:124848235-124848257 GCCCCATTTCTGATTACAGGAGG + Intergenic
1091217376 11:133910952-133910974 GTATACTTTCAGTTTACAGATGG - Intronic
1092647779 12:10596782-10596804 GGACATTCTCTGATTACAGACGG + Intergenic
1092995644 12:13947935-13947957 GAACAATTTCAGTTTAAAAATGG - Intronic
1093984425 12:25513325-25513347 ACACAATTACACAATACAGAGGG + Intronic
1096323681 12:50638904-50638926 GCCAATTTTCAGATTTCAGATGG - Intronic
1098451350 12:70621602-70621624 GCAGAATTTCACATTGCATATGG - Intronic
1098562154 12:71886519-71886541 GCCCAAATTTAGATTACATAAGG + Intronic
1099405088 12:82249603-82249625 GCACAATTTCAGTACAGAGAAGG - Intronic
1100340392 12:93674062-93674084 GCACAATTTCAGATTACAGAGGG + Intergenic
1101450866 12:104777753-104777775 GCACATTTTCAGATGACAAGTGG + Intergenic
1102629050 12:114260896-114260918 GCAGAAGTTCAGAGCACAGAAGG + Intergenic
1102804871 12:115770806-115770828 GCAGAACTTCAGATCACAGGTGG - Intergenic
1105829070 13:24148329-24148351 GCACAATTTCACAGAACACAAGG + Intronic
1107780327 13:43894550-43894572 TCACAATTTAAAATTACAGTTGG - Intergenic
1109238972 13:59859926-59859948 GGACATTTTCAGGTTGCAGAGGG + Intronic
1109251023 13:60021177-60021199 GGAGAAATTCAGATTGCAGATGG + Intronic
1110677961 13:78272494-78272516 GCACATTTTCAAACTGCAGAGGG + Intergenic
1110937724 13:81313349-81313371 ACAAAATTTCAGGTTACAAAAGG + Intergenic
1112642295 13:101289503-101289525 GCACATTTTCAGAACAAAGAAGG - Intronic
1112989778 13:105498151-105498173 ACACAATTTCACATTAAAGTTGG + Intergenic
1114480215 14:23028954-23028976 GCAGAATTTCAGAAGACAGGAGG - Intronic
1115353544 14:32423127-32423149 GGGCAATTTCTGATTAAAGATGG - Intronic
1115674206 14:35651253-35651275 GCAGAATTTCAGATAAGATATGG + Intronic
1117487190 14:56210257-56210279 GCACAAGTTCCAATTGCAGACGG - Intronic
1118529980 14:66693527-66693549 TCAGAATTCCAGCTTACAGATGG - Intronic
1125249526 15:37683737-37683759 CCACACTGTCAGATTACTGAGGG + Intergenic
1125487385 15:40121625-40121647 GCTCAACCTCAGGTTACAGAAGG - Intergenic
1126430175 15:48575046-48575068 GAACATTTGCAGATTAGAGACGG + Intronic
1127680022 15:61285453-61285475 GCATAATTACAGATTACATCAGG + Intergenic
1129669127 15:77597421-77597443 GCTCTATTGCAGATGACAGAGGG + Intergenic
1131366140 15:91842795-91842817 GGAGGATTTCAGATTAAAGATGG + Intergenic
1133476914 16:6132614-6132636 GCACCATTTCAAATTAGCGAAGG + Intronic
1140578521 16:76201051-76201073 GATCAATTTCAGATTCTAGAAGG - Intergenic
1144791279 17:17860787-17860809 GTACAATTTCGGATTACTGAAGG - Intronic
1144864338 17:18325268-18325290 GCACAACTTCAGCTTCTAGAAGG - Intergenic
1147413787 17:40273804-40273826 GCACCATTTCGGATCACAGGTGG - Exonic
1148510599 17:48165804-48165826 GCACCATTTCTGATTTCAGACGG - Intronic
1149692505 17:58589759-58589781 GCACAATCACAGATTACTGCAGG + Intronic
1150977435 17:70104294-70104316 TCTAAATTTCAGATTAGAGAGGG - Intronic
1203159336 17_GL000205v2_random:34805-34827 ACACACTTTCAGATCACAGCAGG + Intergenic
1153493582 18:5674700-5674722 GGACAATTTCAGAGTACATTTGG + Intergenic
1153799852 18:8659479-8659501 CCACAATCTCATCTTACAGACGG - Intergenic
1159402218 18:67953378-67953400 GCACATTTTGACATTACAAATGG - Intergenic
1160161823 18:76479369-76479391 GGAGAATTTCAGAAAACAGAAGG - Intronic
1161788825 19:6346111-6346133 TCAGAATTTCAGATTAACGATGG + Intergenic
1164487869 19:28676647-28676669 ACACAAAATCAAATTACAGATGG + Intergenic
1165283391 19:34816742-34816764 CCACAAGTCCAGATTAAAGATGG + Intergenic
926389155 2:12369683-12369705 GCACCATTTCTGAATACAAATGG - Intergenic
927245961 2:20957426-20957448 GCACAATTCCACATAACAGAGGG - Intergenic
929485493 2:42349992-42350014 GAAAATTTTCAGACTACAGAAGG - Exonic
930821914 2:55654648-55654670 ACTCAAAGTCAGATTACAGATGG - Intronic
932326859 2:70868986-70869008 GGACACATTCAGATTATAGAAGG - Intergenic
933790157 2:85877354-85877376 GAACGGTTTCAGATTAAAGAAGG - Intronic
933865355 2:86511011-86511033 ATACAATCTCAGACTACAGAAGG - Intronic
936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG + Intergenic
936853744 2:116932703-116932725 GAACATTTTCAGTTTTCAGAAGG + Intergenic
937138050 2:119572315-119572337 GCACAGTTTCAACCTACAGAAGG - Intronic
937398735 2:121562858-121562880 GAACAACTTCATTTTACAGATGG - Intronic
939884637 2:147668046-147668068 GCACACTGTCAGAGTAAAGAGGG - Intergenic
941097812 2:161260506-161260528 GTACATTTACAGATTACAAATGG + Intergenic
941697248 2:168566222-168566244 GTAGATTTTCAGATTACATATGG - Intronic
942295705 2:174515135-174515157 GCATAATTTCTGATTAGAGTTGG + Intergenic
942980068 2:182070147-182070169 GGCCACTTTCAGATCACAGAAGG + Intronic
943798217 2:192025353-192025375 GCAAAAATTCAGCTAACAGAAGG + Intronic
943814292 2:192231952-192231974 GCACAATTCCAGTTCAGAGAAGG - Intergenic
944594011 2:201245181-201245203 ACACAATTTCAGATCTTAGATGG - Intronic
945052165 2:205834435-205834457 GCAGCATTTGAGATTACATATGG - Intergenic
946469847 2:219948526-219948548 GTACAAATTAAGATTACAGAAGG + Intergenic
1169905825 20:10602743-10602765 GCCAAATTTCAGATTTCATACGG - Intronic
1170519835 20:17173232-17173254 GCACAGTATGAGACTACAGAAGG + Intergenic
1173944024 20:46935901-46935923 TCAGATTTTCAGATTGCAGATGG - Intronic
1174568609 20:51484912-51484934 GCACATTTTGAAATTACACAGGG + Intronic
1177321190 21:19523246-19523268 CCACAATTCCAGATTACACGAGG + Intergenic
1177509849 21:22072344-22072366 GCTTAATTTCAGATTAAAGCAGG + Intergenic
1178884276 21:36473117-36473139 GCAGAATTTCATTTTATAGATGG + Intronic
1181296755 22:21846407-21846429 GCATATTGTGAGATTACAGATGG - Intronic
949319304 3:2791079-2791101 GCAGAATTTCAGTTTCCACAAGG + Intronic
951039280 3:17970345-17970367 GGACAATTTCAGATTCGACATGG - Intronic
953250102 3:41237916-41237938 GCATACTTTCAGATTACAAAAGG - Intronic
955409805 3:58648271-58648293 GTACACTGTGAGATTACAGAAGG - Intronic
956106716 3:65826964-65826986 GCACAAATTCATATTAGAGCAGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957590741 3:82194257-82194279 GAACAATTTCTGATCACAAAGGG - Intergenic
958782816 3:98563421-98563443 TCAAAACTTCTGATTACAGAAGG + Intronic
958856059 3:99387211-99387233 GCACAATTTCAGATAATGTAAGG + Intergenic
959231758 3:103663214-103663236 GCACAATATAACATTACAAATGG + Intergenic
959401845 3:105912248-105912270 ACACAATTTCAAATCTCAGATGG - Intergenic
961151560 3:124642685-124642707 GCAAAAGTTCAGAATCCAGATGG + Intronic
961802869 3:129466204-129466226 GCTCAATGTCATTTTACAGATGG + Intronic
962442005 3:135429171-135429193 GCAAAATTTCACATTACTGCTGG + Intergenic
964592384 3:158379067-158379089 GCACAAATTCAGGTGAGAGATGG - Intronic
965727154 3:171730182-171730204 ATACAATTTCAGAATACAAAAGG + Intronic
967548058 3:190755729-190755751 GCACAATTTTAAATAACACATGG - Intergenic
967829176 3:193904211-193904233 ACACAATTTCAGTCTGCAGATGG - Intergenic
969554521 4:7897163-7897185 GCTCAATCTCATCTTACAGAGGG + Intronic
972168329 4:36314149-36314171 GAATAACTCCAGATTACAGATGG - Intronic
973965950 4:56162130-56162152 GCACAATTTTGGATCAGAGATGG + Intergenic
974688782 4:65268235-65268257 GCATTGTTTCATATTACAGAAGG - Intergenic
975143801 4:70945231-70945253 CCAGAATATCAGATTACCGAAGG + Intronic
975930038 4:79510047-79510069 GCACATTTTCACATTAAAGCGGG + Intergenic
979615333 4:122735882-122735904 GAACAAATCCAGAGTACAGAGGG + Intronic
982578718 4:157151038-157151060 GAATAATTTCAGATTATAGAAGG - Intronic
986258355 5:6120913-6120935 TCACAACTTCAAATTAAAGAGGG + Intergenic
986259233 5:6128617-6128639 GTACACTTTCAGACCACAGAGGG + Intergenic
986779431 5:11050725-11050747 GCACAAGTTCTGAATAGAGATGG - Intronic
990319848 5:54619186-54619208 TAGCAATTTCAGATGACAGATGG + Intergenic
992196007 5:74339844-74339866 GCACAATCTCAGATCACTGTAGG - Intergenic
993057765 5:83001963-83001985 GCACAATGTCAGGTGGCAGATGG + Intergenic
994876782 5:105433626-105433648 GTATAAGTTCAAATTACAGAGGG + Intergenic
995545895 5:113230322-113230344 ATACAATTTTAGATAACAGAGGG + Intronic
998276313 5:140757328-140757350 GAACCATTTCAGATTAAATAGGG - Intergenic
999141148 5:149362948-149362970 GCCCAATCTCATTTTACAGATGG + Intronic
1003819349 6:9878365-9878387 GCCCAACTACAGATTACAAACGG + Intronic
1008845209 6:55954760-55954782 GAGCTATTTCAGATTACAAATGG + Intergenic
1008959939 6:57256148-57256170 GCACAATTTTACATTACAAAAGG - Intergenic
1010022700 6:71179289-71179311 GAATAATTTCAGAATACAGATGG + Intergenic
1011873980 6:91933297-91933319 GCACATCTTCTGGTTACAGAGGG + Intergenic
1012369863 6:98490435-98490457 GCACAATTAAAGATTCCTGAAGG - Intergenic
1013219215 6:108062377-108062399 ACACAATTTAAGATTATAAATGG + Intronic
1014068385 6:117152836-117152858 GCACATTTTCACATGACAGTAGG + Intergenic
1015867001 6:137737399-137737421 GCCCAATCTCAGATTACTAATGG + Intergenic
1016464020 6:144308319-144308341 GCTTAAATTCAGATGACAGAGGG - Intronic
1017678942 6:156844090-156844112 TCACATTTTCAGTTTACACATGG + Intronic
1018054963 6:160044169-160044191 GGACAATGTCAGTTTACAGTTGG + Intronic
1018223281 6:161603581-161603603 ACAAAATTTCAGAACACAGAGGG - Intronic
1018428028 6:163700739-163700761 CCACAAGTTCAGAATTCAGAAGG - Intergenic
1020563206 7:9758528-9758550 GCAAAATTTCAGAGGACAAACGG - Intergenic
1026900688 7:74035478-74035500 GCACATTTTGACACTACAGAAGG + Intronic
1027867806 7:83670413-83670435 GCCCAATTATAGAGTACAGAAGG - Intergenic
1028843859 7:95458452-95458474 GCACAATAGCAGACTAGAGATGG - Intergenic
1029823217 7:103164404-103164426 GCACAATTTTATTTTAAAGATGG + Intergenic
1030003017 7:105085743-105085765 GCACAATTTCAGCTCACTGCAGG + Intronic
1030525923 7:110655024-110655046 GCACAGTTTCTGAATTCAGATGG - Intergenic
1030738118 7:113075203-113075225 CCACAGTTTTCGATTACAGAAGG - Intergenic
1031340912 7:120599861-120599883 GCATTATTTCTGATTACAGGAGG + Intronic
1032555626 7:132830714-132830736 GCACATTTGCAAATTCCAGAGGG + Intronic
1033056986 7:138065495-138065517 GCAAAATTTAAGATGAAAGACGG + Intronic
1034078424 7:148254361-148254383 CAACAATTCAAGATTACAGAAGG + Intronic
1034652057 7:152699478-152699500 GCACAACTCCAGGTCACAGAGGG - Intergenic
1036055842 8:5252960-5252982 CCAGCATTTCAGAATACAGAAGG - Intergenic
1036572745 8:9996108-9996130 GCTCAAGTTGAGATAACAGATGG + Intergenic
1037054506 8:14422716-14422738 GAATAATTTCAAAATACAGAAGG + Intronic
1038112510 8:24515022-24515044 GCACACTTACAGATTTCAGAGGG + Intronic
1040856892 8:51957940-51957962 AGACAATTTAAGATTGCAGATGG + Intergenic
1041423331 8:57693521-57693543 GCACAGTGTCATATTACAAAGGG - Intergenic
1041984221 8:63901422-63901444 GCACAATTTCAGATTTGATCTGG - Intergenic
1042293848 8:67199050-67199072 GCATAATTTCACATAAGAGAGGG + Exonic
1043310646 8:78855178-78855200 GCAAAATTTCAGATCCCAGCAGG - Intergenic
1044090832 8:87998592-87998614 GAACACTTTCATTTTACAGACGG + Intergenic
1044799604 8:95940516-95940538 GCAATAATTCAGATTAGAGATGG + Intergenic
1044852794 8:96445585-96445607 GCACAGTTTGGGATCACAGAAGG + Intergenic
1045881669 8:107047755-107047777 GAACAGTTTCAGATATCAGAAGG - Intergenic
1046184336 8:110693265-110693287 GCACAACTTCAGTATACACATGG - Intergenic
1046254992 8:111684563-111684585 TCAGAATTTCAAATTATAGAAGG + Intergenic
1046815842 8:118582761-118582783 ACACGATTTCATATTACACATGG + Intronic
1049920770 9:362082-362104 AAATATTTTCAGATTACAGAAGG + Intronic
1050192875 9:3046865-3046887 GCACACTTTAAGATCACAGGAGG + Intergenic
1051284096 9:15477101-15477123 GCAGAATTTCAGATTTCCTAGGG + Intronic
1052008073 9:23374511-23374533 GCCCTATTCCAGATTTCAGATGG + Intergenic
1053319482 9:37082708-37082730 GCACAATTTTCAAGTACAGACGG + Intergenic
1053323797 9:37123397-37123419 GCACAATTTTCAAGTACAGACGG + Intronic
1055258882 9:74408511-74408533 GCACAATATTAGAATATAGAAGG - Intergenic
1056540336 9:87565525-87565547 GCACTAACTCAGGTTACAGATGG + Intronic
1056692365 9:88818815-88818837 GCACAATTGCAGTTTGTAGAAGG + Intergenic
1059844905 9:118264314-118264336 GACTAATTTCAGAGTACAGAGGG - Intergenic
1186546037 X:10450620-10450642 GCACAATTTCTGGTTACGGATGG - Intronic
1186885290 X:13907067-13907089 GCACAATTACAGATTAATTAGGG + Intronic
1192044250 X:67655267-67655289 GCTCAGCTTCAGAATACAGAAGG + Intronic
1192090804 X:68153494-68153516 CCACAATTACAGATAAAAGAAGG - Intronic
1195798347 X:108678889-108678911 GAACTGTTTCAGATTAAAGAAGG - Intronic
1196612919 X:117734443-117734465 GCACAATCTGAGATTACAAGGGG - Intergenic
1199443328 X:147894027-147894049 GCACAAATTCAGACTCCAAAGGG + Intergenic
1199448037 X:147948622-147948644 GGCCAATTACAGATTACAGTAGG + Intronic