ID: 1100340842

View in Genome Browser
Species Human (GRCh38)
Location 12:93677911-93677933
Sequence GGTTAAGTGACCGGGAAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100340842_1100340850 21 Left 1100340842 12:93677911-93677933 CCTGCCTTCCCGGTCACTTAACC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1100340850 12:93677955-93677977 AAGCCACAGCACACTGGTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 233
1100340842_1100340854 26 Left 1100340842 12:93677911-93677933 CCTGCCTTCCCGGTCACTTAACC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1100340854 12:93677960-93677982 ACAGCACACTGGTGCAGGGGTGG 0: 1
1: 0
2: 1
3: 29
4: 271
1100340842_1100340855 29 Left 1100340842 12:93677911-93677933 CCTGCCTTCCCGGTCACTTAACC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1100340855 12:93677963-93677985 GCACACTGGTGCAGGGGTGGTGG 0: 1
1: 0
2: 3
3: 39
4: 419
1100340842_1100340851 22 Left 1100340842 12:93677911-93677933 CCTGCCTTCCCGGTCACTTAACC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1100340851 12:93677956-93677978 AGCCACAGCACACTGGTGCAGGG 0: 1
1: 0
2: 9
3: 95
4: 418
1100340842_1100340848 15 Left 1100340842 12:93677911-93677933 CCTGCCTTCCCGGTCACTTAACC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1100340848 12:93677949-93677971 ACAACCAAGCCACAGCACACTGG 0: 1
1: 0
2: 1
3: 50
4: 236
1100340842_1100340852 23 Left 1100340842 12:93677911-93677933 CCTGCCTTCCCGGTCACTTAACC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1100340852 12:93677957-93677979 GCCACAGCACACTGGTGCAGGGG 0: 1
1: 0
2: 1
3: 34
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100340842 Original CRISPR GGTTAAGTGACCGGGAAGGC AGG (reversed) Exonic