ID: 1100344910

View in Genome Browser
Species Human (GRCh38)
Location 12:93719074-93719096
Sequence TAAGTATGATGTTAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 6, 1: 17, 2: 74, 3: 172, 4: 388}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100344908_1100344910 -2 Left 1100344908 12:93719053-93719075 CCTGGCTGACTTTCTCACTGTTA 0: 1
1: 0
2: 2
3: 27
4: 277
Right 1100344910 12:93719074-93719096 TAAGTATGATGTTAGCTGCAGGG 0: 6
1: 17
2: 74
3: 172
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100344910 Original CRISPR TAAGTATGATGTTAGCTGCA GGG Intronic
901168958 1:7240836-7240858 TAAGTATGATGTTAGCTGTATGG - Intronic
901176768 1:7307551-7307573 TAAGTATAAAGTTAGTTGTAGGG + Intronic
901288422 1:8101670-8101692 TAAGGATATTGTTAGCTGTAGGG - Intergenic
902491424 1:16784827-16784849 CAAGTATAATGTTAGCTATAGGG + Intronic
902848561 1:19133419-19133441 TAAGTATGATGTTAGCACAAGGG - Intronic
904198420 1:28803297-28803319 TAGGAATGCTTTTAGCTGCAAGG + Intergenic
904535369 1:31195922-31195944 TAAGGCTGATATCAGCTGCAAGG - Intronic
905780944 1:40708581-40708603 AATGTATGAAGTTAGCGGCAGGG - Intronic
906969779 1:50499341-50499363 TAGGTAAGATGTTAGCTGTAGGG + Intronic
907181859 1:52577858-52577880 TAAGTATGATTTTAGTGGCTCGG + Intergenic
907715648 1:56923574-56923596 CAAGTATGATGCTAGGTGCTAGG - Intergenic
908062459 1:60366846-60366868 TAAGTTTGATGGTAGGAGCATGG + Intergenic
908701073 1:66900988-66901010 TAAGTATAATGTTAGCTGTGGGG + Intronic
909180533 1:72418865-72418887 TAAGTATTATGTTAAGTGTAGGG - Intergenic
909194352 1:72598356-72598378 AAAGTATGATGTTAGCTGTAGGG - Intergenic
909195845 1:72622271-72622293 TTAATATGATGTTAGCTATATGG + Intergenic
909706498 1:78591244-78591266 TAAATATGATGTTAAGTGAATGG + Intergenic
909799156 1:79783800-79783822 TGTGTATGATATTAGCTGAATGG - Intergenic
910161287 1:84275457-84275479 TAAGTATGATGTTAACTGTAGGG + Intergenic
910165374 1:84322229-84322251 TCAGTATTATGCTAGATGCAGGG - Intronic
910220187 1:84881860-84881882 TGAGTATGATGTTAGCTGTGGGG - Intronic
910315662 1:85880640-85880662 TAAGTATAATGTTGGCTATAAGG + Intronic
911129107 1:94371055-94371077 CAAGTATAGTGTTAGCTGTAGGG + Intergenic
912479328 1:109967782-109967804 TAAGTATGATGTTAGCTGCAGGG - Intergenic
912970731 1:114280422-114280444 TAAGTATGATGTTAGCTATAGGG - Intergenic
913204718 1:116527288-116527310 TACAGATGATGTTAGCTGCAGGG + Intronic
914925874 1:151886784-151886806 TCAGCATGATGTTAGTTGTAGGG - Intronic
915295244 1:154916540-154916562 TAAGTGTGTTGTTAGCAGTAGGG + Intergenic
915612976 1:157009981-157010003 TGAGTATGATGTTAGCTGTGGGG - Intronic
917149191 1:171926925-171926947 TAAGTATGATGGTAGCTATGTGG - Intronic
917550688 1:176024516-176024538 TAAGTATGGTGTTGGCTGTGAGG - Intronic
917832746 1:178910754-178910776 TCAGAATGATGTTGGCTTCATGG + Intronic
917862374 1:179158978-179159000 TAATTATAATAATAGCTGCATGG + Intronic
918539831 1:185618920-185618942 TAAGTATGATGTTCACTGTAGGG - Intergenic
918916781 1:190650937-190650959 TATGTATGATCTTAGCTGAGGGG - Intergenic
918970624 1:191412078-191412100 TAAGTATATTTTTATCTGCAGGG - Intergenic
921435206 1:215111335-215111357 TGAGTATAATGTTAACTGTAGGG + Intronic
921681425 1:218037195-218037217 TAAGTATAATGTTAGCTATGGGG - Intergenic
921782602 1:219184563-219184585 TAAGTGTGATGTTAGTTCTAGGG + Intronic
921810650 1:219509434-219509456 AAAGTTTGATGTTAGCTGCAAGG - Intergenic
922143027 1:222909029-222909051 TGAGGATGATGTGGGCTGCATGG + Intronic
922257229 1:223902931-223902953 GAAGGATGATGTGAGCAGCAAGG + Intergenic
922694967 1:227726105-227726127 GAAGCATGGTGTTAGCTGCAGGG + Intergenic
923420008 1:233803928-233803950 TAAATATGATGTTAGCTATAGGG - Intergenic
923529019 1:234797715-234797737 CAAGTATAATGTTAGCTATAGGG - Intergenic
923650485 1:235868332-235868354 TAAGTATTGTGCTAGGTGCATGG + Intronic
923878697 1:238079001-238079023 TAAGTATGATGTGAGCTGTGAGG + Intergenic
924389767 1:243540955-243540977 TAAGTAAGATGTTGACTTCATGG - Intronic
924505219 1:244676667-244676689 TAAGTATGATATTAGCTGTGAGG + Intronic
924827088 1:247550919-247550941 TAAGTACGATGTTCTCTGAAGGG - Intronic
924842960 1:247733711-247733733 TAACTATGATATTAGTTGCAGGG - Intergenic
1062778022 10:171757-171779 TAAGTATGATGTTAGCTGTAGGG - Intronic
1063844330 10:10108732-10108754 TTTGTATGATGTTATCTTCATGG - Intergenic
1064234193 10:13558344-13558366 TAAGCATGATGCTAGCTCTAGGG - Intergenic
1064448328 10:15417533-15417555 TAAGTCTAATGTTACCTGTAGGG - Intergenic
1064465817 10:15580804-15580826 CAAGTTTGATGCCAGCTGCAGGG - Intronic
1064690051 10:17907700-17907722 TAAGTAAGAAGTTTGTTGCATGG + Intronic
1065243424 10:23731713-23731735 TAAGTATAAGGTTAGCTGTAGGG + Intronic
1066118514 10:32261576-32261598 TGAGTATAATGTTAGCTGTGGGG + Intergenic
1066544408 10:36483533-36483555 TAGGTACAATGTTAGCTGTAAGG - Intergenic
1066548588 10:36529596-36529618 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1066693690 10:38059240-38059262 CAAGGATAATGTTAGCTGTAGGG - Exonic
1067983019 10:51108652-51108674 TAAGTATGATGTTAGCTGTGGGG - Intronic
1068655710 10:59574068-59574090 TAAGTATGATATTAGCTGTAGGG - Intergenic
1069022916 10:63509041-63509063 CAACTATGATATTAGCTGTAGGG + Intergenic
1071047141 10:81394247-81394269 TAAAGATGATGTTAGTTACAGGG + Intergenic
1071236338 10:83654394-83654416 TAAGTATGATGTTAACTGTGGGG + Intergenic
1071606119 10:86991894-86991916 GAAGTATTATGTTAGCTGCAGGG - Intergenic
1071815665 10:89230263-89230285 TCAGTATAATGTCAGCTCCATGG - Intronic
1071956388 10:90764781-90764803 TGAGTATGATGTTAACTAAAAGG + Intronic
1072026576 10:91465538-91465560 TAATTATGATGTTAGCTGTAGGG + Intronic
1072338838 10:94426271-94426293 TAAGTATGATGTTAGCTGTAGGG + Intronic
1073317056 10:102589884-102589906 CAAGTATGATGTTAGCTGTGGGG + Intronic
1073501667 10:103944464-103944486 TAAGTATTTTGTTTGCTGTATGG + Intergenic
1073710666 10:106034987-106035009 TAAGTATGATTTTAGATATAGGG + Intergenic
1073898358 10:108189342-108189364 TCAGTATGATGTCAGCTACTGGG - Intergenic
1074481966 10:113831590-113831612 TAAATATGATGTTAGCTGTAGGG - Intergenic
1077212636 11:1379474-1379496 TAAGAATAATGTTAGCTGGCCGG - Intergenic
1078332218 11:10433458-10433480 TAGGTATGATGTTAGCTGTGGGG - Intronic
1078403799 11:11050260-11050282 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1078719156 11:13868147-13868169 TAGGTATGATGGTAGCTATAGGG - Intergenic
1078942450 11:16023048-16023070 TAATTATGATGTCATCTGGAAGG - Intronic
1079539189 11:21551455-21551477 TCAGTATGATATTGGCTGTAAGG + Intronic
1079700974 11:23547131-23547153 TAGGTACGATGTTAGCTGTAGGG + Intergenic
1080319835 11:30994802-30994824 TGAGTATGATGTCAGCTGTAGGG - Intronic
1080594892 11:33763648-33763670 TAAATAAGATGTTTGCTGTAGGG - Intronic
1081099526 11:38985283-38985305 TAAGTTTCATGGTAGCTACAAGG - Intergenic
1081502127 11:43677222-43677244 AAACTATGAAGTTAGCTGCAAGG + Intronic
1081723891 11:45311988-45312010 TAAGTATAATGTTTGCTGTAGGG + Intergenic
1082248933 11:49959084-49959106 TAAGAACGATGTTGGCTGTAGGG - Intergenic
1082562025 11:54629266-54629288 TAAGTACAATGTTGGCTGTAGGG + Intergenic
1084552378 11:69852653-69852675 TAAGTATGCTGTTATCTGTGGGG + Intergenic
1084633113 11:70369106-70369128 TAAGTATGATGTTCACTGTAGGG + Intronic
1084985068 11:72862146-72862168 TAAGTATGAAGTTAGCAGTAGGG - Intronic
1085284026 11:75348547-75348569 GGAGTATGATGGTTGCTGCAAGG - Intronic
1085647597 11:78236578-78236600 TAGGTATGATCTTAGCTATAGGG + Intronic
1086172683 11:83853756-83853778 TAGGCATGATATTAGCTGTAGGG - Intronic
1089194328 11:116684385-116684407 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1089515330 11:119028425-119028447 TAAGTGTAATGTTCCCTGCAGGG - Exonic
1089592293 11:119550814-119550836 TAAGCATGATGTTTGCTGCAGGG - Intergenic
1090130063 11:124131926-124131948 TAAGTATGGTGTTTGCTGTAAGG + Intronic
1090143160 11:124287948-124287970 TAAGCATGATGTTAACTGTAAGG + Intergenic
1090301829 11:125648777-125648799 TAAGTATGATGTTAGCTGTGGGG + Intronic
1090320235 11:125836825-125836847 AAAGGATGATGTTAGTTGCTGGG - Intronic
1090724216 11:129508671-129508693 TAAGTAAAATGTTAGTTGTAGGG + Intergenic
1091125045 11:133087293-133087315 TAAGTATTATTTTAGGTGTAGGG + Intronic
1091324388 11:134674837-134674859 TAAGTATGATGTTAGCTGTGGGG - Intergenic
1091412159 12:250172-250194 TAAGTATGATGTTAGCTGTAGGG - Intronic
1091477817 12:794424-794446 TAAGCATAATGTTAGCTGTGGGG + Intronic
1091892091 12:4065772-4065794 TAAGTATAATGTTTGTTGTAGGG + Intergenic
1092131620 12:6117089-6117111 TCTCTATGATGTTAGCAGCACGG + Intronic
1092299796 12:7236093-7236115 TGAGTATGATGTGAGCTGTGGGG - Intergenic
1092510983 12:9156428-9156450 TAATTATGATGGTAGCTGAAAGG + Intronic
1093207920 12:16272703-16272725 TTGGTATGTTGTTAACTGCATGG + Exonic
1093248928 12:16775598-16775620 TAAGTATGATGTTAGCTGTAAGG - Intergenic
1093274141 12:17103081-17103103 TAAGCATGGTAGTAGCTGCAGGG + Intergenic
1093582633 12:20801344-20801366 GAAGTATGATGCTAGCTATAGGG - Intergenic
1093616319 12:21229976-21229998 TAAGTATGAAGTTAGATGTAGGG + Intronic
1093720283 12:22434337-22434359 TAACTGTGATGTTATCTGCATGG - Intronic
1095150887 12:38795842-38795864 TAAATATGATGATAGATGGATGG + Intronic
1095880103 12:47126118-47126140 TAGGTATGATGATAACTGTAAGG + Intronic
1095901324 12:47331597-47331619 TAAGTATGATGTTAGCTGCAGGG + Intergenic
1096014969 12:48262507-48262529 TAAGTATGATGTGAACTATAGGG + Intergenic
1096128909 12:49141565-49141587 TAAGTATAGTGTTAGCTGTAGGG + Intergenic
1097868932 12:64583990-64584012 AATGTATGATTTTAGCTGGACGG - Intergenic
1097900482 12:64868138-64868160 TAAATATGATATCATCTGCATGG - Intronic
1098486635 12:71028991-71029013 TAACTAAAATGTAAGCTGCAAGG + Intergenic
1099788036 12:87292528-87292550 TAAATATGATATTAGCTGTAGGG - Intergenic
1100344910 12:93719074-93719096 TAAGTATGATGTTAGCTGCAGGG + Intronic
1100683374 12:96955844-96955866 TAAGTTTAATGTTAGCTGCTGGG - Intergenic
1100872775 12:98928823-98928845 TAAGTATTATTTTAGCCGTATGG - Intronic
1105952047 13:25238000-25238022 TGAGTATGGTGTTAGCTGTGGGG - Intergenic
1106238915 13:27892098-27892120 TGAGTATGATATTAGCTGTGAGG + Intergenic
1106299037 13:28446185-28446207 TAAATATGATGTTAGACGTAGGG - Intronic
1107643204 13:42465949-42465971 TAAGTATAATTATAGCTGCTGGG + Intergenic
1108012321 13:46030256-46030278 TAGGTATGACGTTAGCCGTAGGG - Intronic
1108097270 13:46916354-46916376 TAAGTATAATGTCAGCTGTAGGG + Intergenic
1108111327 13:47076668-47076690 TCAGTATGATGTTGACTGCGAGG - Intergenic
1108368150 13:49738946-49738968 TAAGTGTGATGTTAGCTGTGAGG + Intronic
1108567667 13:51717050-51717072 TAAGGATGATGTTAGCTGCAGGG - Intronic
1108955023 13:56142568-56142590 TAAGGATTATGTTAGATGCAAGG - Intergenic
1109117275 13:58404550-58404572 TCAGTATGATGTTGGCTGTGGGG + Intergenic
1110248041 13:73349691-73349713 TAATTGTGATGTTACCTGTAGGG - Intergenic
1110515235 13:76403936-76403958 AAAGTATCATATTTGCTGCAAGG - Intergenic
1113417828 13:110144040-110144062 TAAATATGATGTTAACTATAGGG - Intergenic
1113705273 13:112426990-112427012 GAAGGATGATGTTAGCTGCAGGG + Intronic
1113754463 13:112801018-112801040 TAAGTATGACGTCAGCTGTAGGG - Intronic
1114232201 14:20793234-20793256 TGAGTATAATGTTAACTGTAGGG + Intergenic
1114276215 14:21147514-21147536 TAAATATAATGTTAGCTGTGCGG - Intergenic
1114941769 14:27621966-27621988 TAAGTATAATGTTAGCTGTAAGG - Intergenic
1115317666 14:32042359-32042381 TCAATATGATGTTAGCTGTAGGG + Intergenic
1116558530 14:46345345-46345367 ACAGTATGATATTAGCTGAAGGG - Intergenic
1117259392 14:54015235-54015257 GATGTATGATGTTAACCGCAGGG + Intergenic
1117888221 14:60388053-60388075 GAAGTATAATGTTAACTGTAGGG - Intergenic
1117888525 14:60392019-60392041 GAAGTATAATGTTAACTGTAGGG - Intergenic
1117951487 14:61086968-61086990 TAGGTATAATATTAGCTGTAGGG - Intergenic
1118131609 14:62970890-62970912 TGAGTATGATGTTAGTTGTAGGG - Intronic
1118361204 14:65058571-65058593 TAAGCATGATGTTTACTGTAAGG + Intronic
1118413205 14:65504188-65504210 AAAGTAGGATGTTAACTGTATGG + Intronic
1119092118 14:71793610-71793632 TAAGTAAGATGTTAGCTGTTGGG + Intergenic
1120833620 14:89020802-89020824 TACGTATGATGTTAGCTGTGGGG + Intergenic
1121246881 14:92467432-92467454 TAAGTATGATGTTAGCTTTGGGG - Intronic
1121384936 14:93511331-93511353 TAAGCATGCTATTAGCTGTAGGG + Intronic
1121797599 14:96747946-96747968 TGAGTATGATTTTAACAGCAGGG + Intergenic
1121978751 14:98433143-98433165 TAACTCTAATGTCAGCTGCATGG + Intergenic
1122676206 14:103416277-103416299 TAAGTGGGATGGTAGCTACAGGG + Intronic
1123451342 15:20363519-20363541 CAAGTATAATCTTAGCTGTAGGG - Intergenic
1123979011 15:25582127-25582149 TCAGTATAAAGTTAGCTGTAGGG - Intergenic
1124086678 15:26557413-26557435 TAACTATCATCTTAGCTTCAAGG - Intronic
1124177965 15:27443759-27443781 TAAGTGTGATATTAGTTGGAGGG + Intronic
1124607669 15:31183338-31183360 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1125247340 15:37656003-37656025 TTAGTATGATGTTAGCTGTAGGG - Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1126043534 15:44616829-44616851 TAAATATGATGTTGGCTAGAAGG - Intronic
1126043682 15:44618167-44618189 TAAGTATGATGTTGGCTAAAAGG + Intronic
1126200939 15:45985396-45985418 TAAGTATGATGTTATCTGTGGGG + Intergenic
1126275176 15:46869737-46869759 TAATTCTGCTGTTCGCTGCAGGG - Intergenic
1126340075 15:47630708-47630730 TACGTATGATATTAGCTGTTGGG + Intronic
1128102378 15:65013423-65013445 TAAGTATGATGTTAGTTACAGGG + Intronic
1128339025 15:66807377-66807399 TAAGCGTGATGTTAGCTCTAAGG - Intergenic
1128432174 15:67607164-67607186 AAAATATGATCTTGGCTGCAAGG - Intronic
1128575285 15:68770130-68770152 TAAATATGATGGCAGCTCCAGGG - Intergenic
1129307805 15:74680528-74680550 TTAGTATAATGTTAGCTGTAGGG - Intronic
1129480247 15:75818853-75818875 TAAGCATGATGTTATCTGTGGGG + Intergenic
1130035439 15:80356711-80356733 TAAGTATGAAGTTTGTTGTAGGG + Intronic
1130245460 15:82243935-82243957 TATGTGTGATGTGAGCTCCAAGG - Intronic
1130455227 15:84099421-84099443 TATGTGTGATGTGAGCTCCAAGG + Intergenic
1130602913 15:85289588-85289610 TGAGTCTGGTGGTAGCTGCATGG + Intergenic
1130807329 15:87338666-87338688 TAAGTATAATGTTAGTTCTATGG - Intergenic
1131892604 15:96988649-96988671 TAAGTATGATGTTTGCTATGGGG + Intergenic
1132108295 15:99082033-99082055 TAAGAATGATGTTAGTTGTGGGG - Intergenic
1132407246 15:101551279-101551301 TAAGTATGATGCTTGTTGTAGGG - Intergenic
1132411852 15:101585513-101585535 TAAGTATAATTTTAGCTGTAAGG + Intergenic
1133578678 16:7121142-7121164 TAAGTATGATATTAGCTGTGGGG - Intronic
1135176714 16:20236377-20236399 TCAGTAGGGTGTTAGGTGCATGG - Intergenic
1135900008 16:26448927-26448949 TAAGTACAATCTTAGCTGTAGGG + Intergenic
1136123262 16:28155908-28155930 TAAGTCTGAGATTAGCTGGAAGG - Intronic
1136714574 16:32267728-32267750 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1136753314 16:32661687-32661709 CAAGTATGATGTTAGCTGTGGGG - Intergenic
1136814799 16:33208678-33208700 CAAGTATGATGTTAGCTGTGGGG + Intronic
1136821275 16:33318758-33318780 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1136827838 16:33375297-33375319 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1136832904 16:33474068-33474090 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1137298044 16:47116113-47116135 TAAGTATGGTGTCAGCTGTAGGG + Intronic
1137520164 16:49186971-49186993 TAAGTAGGATATTAGCTGTAGGG + Intergenic
1137535310 16:49317732-49317754 TAAGTGTGATATTAGCTGTATGG + Intergenic
1137618970 16:49863750-49863772 TGAGTAGGATTTCAGCTGCATGG + Intergenic
1139154891 16:64428826-64428848 TATGCATCACGTTAGCTGCATGG - Intergenic
1139414051 16:66792303-66792325 TAAGTATGATGTTTGCTGTAGGG - Intronic
1139565810 16:67775331-67775353 TGAGTATGATGTTAGCTGTGGGG - Intronic
1140051778 16:71487921-71487943 TAAGTATGTTTGCAGCTGCAAGG - Intronic
1140159956 16:72479297-72479319 TAAGTATAATATTAGCTGTAGGG - Intergenic
1140623438 16:76763866-76763888 TAAGTATGACGTTAGCTGTAGGG - Intergenic
1140973230 16:80033850-80033872 TAAGTATGATGTTAACTGTGGGG - Intergenic
1141208314 16:81952924-81952946 TGATTAAGATGGTAGCTGCAGGG - Intronic
1141517833 16:84558276-84558298 TAAGTAAGATGTTAGCATCTGGG - Intergenic
1142321831 16:89388124-89388146 TATGTATGATGTTAGCATTAGGG - Intronic
1202993375 16_KI270728v1_random:31652-31674 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1203055476 16_KI270728v1_random:922041-922063 CAAGTATGATGTTAGCTGTGGGG - Intergenic
1144163824 17:12587896-12587918 TAAGTACGATGTTAGATGCTGGG - Intergenic
1144171008 17:12659994-12660016 TAACTATGATTTTAAGTGCAAGG - Intergenic
1144188350 17:12818357-12818379 TAAATATGATGTGAGTTGTAGGG - Intronic
1145368598 17:22287675-22287697 TCAGTATGATCTTAGCTGTAGGG + Intergenic
1146556606 17:33830392-33830414 TGAGCATGATGTTAGCGGGATGG + Intronic
1148199253 17:45738912-45738934 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1148263455 17:46204991-46205013 TAAGTATGATTTTAGCTATGGGG - Intronic
1148370026 17:47092055-47092077 TAAGTATGATTTTAGCTATGGGG - Intergenic
1148585489 17:48775926-48775948 TAAGTATGATGTTAGCTGTCAGG - Intronic
1150021844 17:61624104-61624126 TAGGTATGATATTAGCTGTAGGG + Intergenic
1150024408 17:61657097-61657119 TAAGTATGATGTAAACTGTGTGG + Intergenic
1152548540 17:81016926-81016948 TAAGTGTGATGTTATCTGTAGGG - Intergenic
1152593546 17:81226145-81226167 TAAGTATGATGTCAGCTGAGGGG + Intergenic
1153792470 18:8591933-8591955 TCACCATGATGTTAGCTGTAAGG - Intergenic
1154003097 18:10502183-10502205 TGAATATGATGTTAGCTGTGAGG + Intergenic
1155084061 18:22439430-22439452 TAAATATGATGTAAGCTACTGGG - Intergenic
1155513635 18:26602102-26602124 TAAGTATGATGTTAGTTGTGGGG + Intronic
1155589992 18:27416464-27416486 TAAGTATGATGTTCACTGCAGGG - Intergenic
1155601193 18:27550117-27550139 TAATTTTAATGGTAGCTGCATGG - Intergenic
1156079366 18:33315466-33315488 TAAGTAGGATGGTAGCTAAAGGG - Intronic
1156338797 18:36191991-36192013 TAAGTATGATGTTAGCTGTGGGG - Intronic
1156380094 18:36551027-36551049 TAAGTATGATGTTATCTGCAGGG + Intronic
1156439002 18:37165368-37165390 TAAGTATGATTTTAGCTGAAGGG + Intronic
1156771338 18:40730424-40730446 TCAGAATGAAGGTAGCTGCAGGG - Intergenic
1156926763 18:42590848-42590870 TAAGTGTGTTGTTAGCTGTAGGG + Intergenic
1157078050 18:44489348-44489370 TAAGTATGATATTTGATGTAAGG + Intergenic
1157275341 18:46306626-46306648 TAAGTATGCTGTTAGGTGTAGGG + Intergenic
1157540586 18:48501765-48501787 TAAGTATAATGTAAGCTGTGGGG - Intergenic
1157637509 18:49173959-49173981 TAAGTATGATTTTAGCTGTAAGG + Intronic
1157646286 18:49276182-49276204 TAAATATGATGTGAGCTGTGGGG + Intronic
1158433303 18:57412384-57412406 TTAGTATAATGTTAGCTGTTGGG - Intergenic
1159173338 18:64801856-64801878 TAGGGGTGATGTTAGCTGTAGGG - Intergenic
1160580395 18:79880986-79881008 TATGTATGTTGTTAGCTGTAGGG - Intronic
1163226780 19:15967638-15967660 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1164264889 19:23606042-23606064 TCAGTATGATATTGGCTGCAGGG + Intronic
1165065981 19:33227936-33227958 TAAACATGATGTCAGCTGTAGGG - Intergenic
925784231 2:7413887-7413909 TAAGCATGATGTTAGTTGTAGGG + Intergenic
926234804 2:11032213-11032235 TAAGTAAGATGATATCTGTAAGG + Intergenic
926485635 2:13452765-13452787 TAAGTATAATCTTAGCTGTAGGG + Intergenic
927037755 2:19198079-19198101 TAAGTATGATGTTAGCTATAGGG - Intergenic
927302442 2:21531129-21531151 TAAGTATGACGTTAGATGAAGGG + Intergenic
927409126 2:22805336-22805358 TCAGTATCATGAGAGCTGCATGG + Intergenic
927444497 2:23146390-23146412 TAAGCATGATGTTAGCTGTGGGG - Intergenic
928402356 2:30988256-30988278 TCAGTAGGACCTTAGCTGCAAGG + Intronic
928892936 2:36226440-36226462 TTAGTATGAAGTTAGATGTAGGG - Intergenic
929767792 2:44863509-44863531 TAAGTGTGATTTTAACTGTAGGG - Intergenic
929833909 2:45376351-45376373 GAAGTATGATGTTAGCTATGTGG - Intergenic
929838983 2:45436288-45436310 TAAATGTTATGTTAGCTGTAGGG - Intronic
930433532 2:51312355-51312377 TAAGTATGATTTTAGGTGTGAGG - Intergenic
930839548 2:55830271-55830293 TAAGAATAATGTCATCTGCAAGG - Intergenic
930949751 2:57126201-57126223 TAAATATTATGTTAGCTGCAGGG + Intergenic
931003673 2:57821665-57821687 TAATTATAATGTTAGCTGTAGGG - Intergenic
931273592 2:60724019-60724041 AAAGTATGATGTTAGTTGTAAGG - Intergenic
931315896 2:61131082-61131104 TAAGTGTAATGTTAGCTGTGGGG - Intronic
931446949 2:62334719-62334741 TCAGTAGAATGTAAGCTGCATGG - Intergenic
931772465 2:65509981-65510003 TAAGTATGATGCTAGCTGTAGGG + Intergenic
931939871 2:67240534-67240556 TAAGCATGTTGTAAACTGCAAGG - Intergenic
932293108 2:70600082-70600104 TAAGTATACTGTTAGCTGTAGGG + Intergenic
932470875 2:71955685-71955707 TAAATATGATGTTAGCAAAAGGG + Intergenic
932964151 2:76451006-76451028 TCAGTATGATGGTAGCTGTAGGG - Intergenic
933189411 2:79317008-79317030 TAAGTATTATGTTACATGTAGGG + Intronic
933722184 2:85405041-85405063 TAAATATAATGTTAGGTGAAGGG - Intronic
933838782 2:86268030-86268052 TAAGTCTAATGTTAGCTGTAGGG - Intronic
935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG + Intronic
935231706 2:101103732-101103754 TAAGTATGATGTTAACTGTGGGG - Intronic
935320352 2:101881637-101881659 TATGTATGACGTTAGCTGTAAGG + Intronic
935343346 2:102079145-102079167 TAAGTATAATGTTAGCTGTGGGG - Intronic
935750469 2:106228655-106228677 CAAGTATGATGATAGCTTTAGGG + Intergenic
937420580 2:121751603-121751625 TAACTATGATGTTAGCTGTAGGG - Intronic
937604806 2:123786346-123786368 TAAGTATGACATTAGCTGTGGGG + Intergenic
937850621 2:126630743-126630765 TGAATATGATGTTAGCTGTAGGG - Intergenic
937959534 2:127445220-127445242 TAAGTACGATGTTAACTGTAGGG + Intronic
938070370 2:128305231-128305253 TAAGAATGATGTTCTCTGCTGGG + Intronic
938181039 2:129183184-129183206 TAAGTATGATGTTAGCTAAAGGG + Intergenic
938222671 2:129584481-129584503 TAAGTATGATGTTAGCTGTGGGG - Intergenic
939138703 2:138327026-138327048 TAAGTATGATGTTAGCTGCTAGG - Intergenic
939841380 2:147192449-147192471 TGAGTATGATGTTAGCTGTAGGG - Intergenic
940313157 2:152300531-152300553 TAAGAACGATGTTAGCTGTAGGG + Intergenic
940545180 2:155073911-155073933 GAAGTATGAAGTTACCTCCAGGG - Intergenic
941402822 2:165052430-165052452 TAAGTATGATGGTAGCTGTAGGG - Intergenic
941539098 2:166760235-166760257 TAAGTATAATATTAGCTGTAGGG + Intergenic
941603761 2:167569774-167569796 TAAGTGTAATGGTAGCTGTAAGG + Intergenic
941802653 2:169677594-169677616 TAAGTATGATGCTAAGTGTATGG - Intronic
942140072 2:172968587-172968609 TAAGGATGATGGTATCTGCTGGG - Intronic
942982942 2:182104293-182104315 TGAGTATGATGTTAGCTATGGGG + Intronic
943349762 2:186783674-186783696 TCAGTATGCTGTTAGCTGTAGGG - Intergenic
944162760 2:196683131-196683153 TAAGTATGATGTCAACTGTGGGG + Intronic
944766098 2:202865503-202865525 TAAGGATGATGTTAGCTCTGTGG - Intronic
946664810 2:222037435-222037457 TAAGTGTGATGGAAGCTGCTGGG - Intergenic
947055469 2:226095654-226095676 TCAGTATGCTGTTAGCTGTGGGG - Intergenic
947075475 2:226339813-226339835 TATGTATGATGTCATCTGTAGGG - Intergenic
947965023 2:234272922-234272944 TAAGAATGACCTTAACTGCAAGG - Intergenic
1169048116 20:2553208-2553230 TAAGTATGATGTTAGTTGTAGGG + Intronic
1170410840 20:16089571-16089593 TGAGTATAATGTTAGCTGTGAGG - Intergenic
1170722298 20:18893696-18893718 TCAATATGATGTTAGCTGTAGGG - Intergenic
1170992591 20:21317201-21317223 CAAGTATGATGTTAACTGTTAGG + Intronic
1171338037 20:24404994-24405016 TAAGTATCATGTTAATTGCAGGG + Intergenic
1171378823 20:24716582-24716604 TAAGTATGATATTAACTGTGGGG + Intergenic
1171402605 20:24886958-24886980 TGAGTATGGTGTTTGCTGTAGGG - Intergenic
1172616757 20:36293338-36293360 TAAGTGTGATGTTAGCTATAGGG + Intergenic
1172769293 20:37369747-37369769 TAAGTAGGATGTTAGCTCTGGGG + Intronic
1175662639 20:60828299-60828321 CAAGTATGCTGTTAGCTGTAGGG + Intergenic
1177133784 21:17289219-17289241 TAAGTATAATATTAGCTGAAGGG - Intergenic
1177621222 21:23597077-23597099 TAAGTATGATGTTTGCTTTTGGG - Intergenic
1177730146 21:25018295-25018317 TCAGTTTGATTTTACCTGCATGG + Intergenic
1178220748 21:30656486-30656508 TAACTTTGATGTTAGCTGTGGGG - Intergenic
1179018093 21:37611855-37611877 TTAGTATGATGTTAGCTGTAAGG - Exonic
1179378477 21:40875628-40875650 TAAATATTATGTTAGCTGTGGGG - Intergenic
1179903980 21:44411708-44411730 TAAGTGTGATGTTAGCTGTGGGG + Intronic
1179904050 21:44412672-44412694 TGGGTATGATGTTAGCTGCAGGG + Intronic
1181381950 22:22512299-22512321 TAATTGTGATGTTAGCTGTGGGG - Intergenic
1181900371 22:26149796-26149818 TAAGGATGATGTTAGCTGTAGGG - Intergenic
1182058124 22:27377080-27377102 TAAGTAAGATTTTAACTGCTAGG - Intergenic
1182141087 22:27959001-27959023 TAAGTATCATGCTGGCTTCAGGG - Intergenic
1182949507 22:34359351-34359373 TGAGTATGATGTTTGCTGCGGGG - Intergenic
1183750421 22:39716847-39716869 TAAGGAAGATGTGAGCTGCTAGG + Intergenic
1184641582 22:45875351-45875373 TAAGTGTGATTTTATCTGCAGGG - Intergenic
1185230927 22:49681622-49681644 GAAGTATAATGTTAGCTGAAAGG + Intergenic
949292198 3:2480147-2480169 TAAGTATGATGTTAACTGTAGGG - Intronic
950777917 3:15366226-15366248 CAAGTATGAAATTAGCTGTATGG + Intergenic
952110354 3:30116090-30116112 TAAATATGATGCTAGCTGAAGGG - Intergenic
953183325 3:40616328-40616350 TCATTATGATATTAGCTGCCAGG - Intergenic
953487233 3:43312517-43312539 TAAGTAGGATGTTATCTGTAGGG - Intronic
953822371 3:46218856-46218878 TCAGTATAATGTTAGCTGTGGGG - Intronic
953892749 3:46765997-46766019 TAAGTATGATTTTACCTGTGGGG - Intronic
954509346 3:51108224-51108246 TAAGAATGATGATACCAGCATGG - Intronic
954666926 3:52259642-52259664 TAAGAATTATGTTAGCTGGTTGG - Intronic
954879829 3:53826633-53826655 CAGGTATGATGTTAGTTGTAGGG - Intronic
955262795 3:57410901-57410923 TAAGTATGATGTTAGCTGTAGGG - Intronic
955476964 3:59347135-59347157 TAAGTATGAGGTAAGCGACAGGG + Intergenic
957841321 3:85673624-85673646 TAAGTAAGATGTTAACAGGAAGG + Intronic
959846782 3:111041926-111041948 TCAGTATGATGTTAGCTGTGGGG - Intergenic
959865423 3:111263646-111263668 TGAATATGATGCTAGCTACAGGG - Intronic
959881768 3:111451689-111451711 TCAGTATGATGTTGGCTGTGGGG - Intronic
960020036 3:112939149-112939171 TTAGTATAATATTAGCTACATGG - Intronic
960118567 3:113923380-113923402 TCAGTATGATGTTGGCTGTGCGG + Intronic
960489112 3:118290217-118290239 CAAGTATGATGCTAGCTGCAAGG + Intergenic
961423221 3:126824163-126824185 TAATTATGTTGTTAGCTGGTAGG + Intronic
961727078 3:128938400-128938422 TATCTATGATGTTAGGTGTAGGG - Intronic
961946460 3:130694893-130694915 TAAGTACAATGTTAGCTGTAGGG + Intronic
962299595 3:134226837-134226859 TGAGTATGATATTAGCTGTAGGG - Intronic
962441357 3:135420249-135420271 TAAATATGATGTTAGCTGTGGGG + Intergenic
962955285 3:140260327-140260349 TAAGTATGATATTAGAAGTAGGG + Intronic
963012435 3:140784835-140784857 TAAGTATAATGTTAACTGTAAGG - Intergenic
963381796 3:144539818-144539840 TTAGTATGATGTTGGTTGTAGGG - Intergenic
963655677 3:148046523-148046545 TAAGTAGAATGTTAGTTGTAGGG + Intergenic
963725743 3:148919294-148919316 TAAGTATAATGTTAGCTGTAAGG - Intergenic
964311163 3:155394492-155394514 CAAATATGATGTTATCTGTAGGG + Intronic
964922845 3:161918798-161918820 TCAGTATGATGTTGGCTGTGGGG + Intergenic
966545771 3:181145902-181145924 TAGGTATGATGTTAGCTTGTAGG - Intergenic
966931930 3:184680981-184681003 TAAGTATGAATTTACCTCCATGG - Intronic
966965578 3:184989221-184989243 TAAGTATGATGTTAGCTGCAAGG + Intronic
967230374 3:187332253-187332275 TAGCTATGATGATAGCAGCATGG + Intergenic
968242899 3:197107929-197107951 TTAGTATGATGTCAGCTATAGGG + Intronic
968796470 4:2708976-2708998 TAAGTAAGATGTTGGCTTTAGGG + Intronic
968952337 4:3701595-3701617 TAAGGAGGATGTGAGCTGGATGG - Intergenic
970073542 4:12191138-12191160 AAAGTATCTAGTTAGCTGCATGG - Intergenic
970083039 4:12310982-12311004 TGAGTATGACGTTAGCTGTGGGG + Intergenic
970411548 4:15813231-15813253 TATGTATAATGTTAGCTGTGGGG + Intronic
971094106 4:23378441-23378463 TAAGCTTGATGTTAGGTACAGGG - Intergenic
971285182 4:25282047-25282069 TAAGTACGATGTTTGCTGTTGGG - Intergenic
971991770 4:33907621-33907643 TAAACATGATATTAGCTGTAGGG - Intergenic
972121310 4:35707720-35707742 TCAGTATGATGTTGGCTGTAGGG + Intergenic
972984407 4:44746103-44746125 TCAGTATGATATTCGCTGAATGG + Intergenic
972999969 4:44935053-44935075 AAAATAATATGTTAGCTGCAAGG + Intergenic
973000987 4:44950560-44950582 TAAATTTGATGTTAGTTTCAGGG - Intergenic
973286094 4:48418273-48418295 TAAGTATAATGTTAACTGTAGGG + Intronic
974480851 4:62441191-62441213 TAAGTGTGATGTTAGTTGTAGGG + Intergenic
975567089 4:75768742-75768764 TAAGTATGATGTTAGCTGTAAGG + Intronic
976126811 4:81841924-81841946 TAAGTATGATGTGAGGTGGGAGG - Intronic
976200725 4:82575738-82575760 TGAATATGATGTTAGCTGTGGGG + Intergenic
976357816 4:84140228-84140250 TGAGTATGATGTTAGCTGTAGGG - Intergenic
976768617 4:88625763-88625785 TAAGTGTGATGTTAACAGTAGGG + Intronic
977751178 4:100611434-100611456 TGAATATGATGTTAGCTCTAGGG + Intronic
977906901 4:102487465-102487487 TCAGTATAATGTTGGCTGCGGGG - Intergenic
978020581 4:103806289-103806311 TAGGTAGAATGTTAGCTGTAGGG + Intergenic
978074113 4:104507688-104507710 TAAGTCTTATGTTAGCTTCATGG + Intergenic
978348929 4:107801059-107801081 AAAATATAATGTTAGCTACATGG - Intergenic
979821570 4:125179897-125179919 TAAGTATGACGTTACCTGGTGGG - Intergenic
980256042 4:130382175-130382197 TTAGTCAGAAGTTAGCTGCAGGG + Intergenic
981598676 4:146458342-146458364 TAGGTATGATGTCAGCTGTTTGG - Intronic
982119045 4:152122295-152122317 TAAATATGATGTTAGATGTAGGG + Intergenic
982510246 4:156273687-156273709 TTAGTATGATGCTGGCTGCAGGG + Intergenic
983784926 4:171718622-171718644 GAGCTATGATGTTAGCTGCCAGG - Intergenic
984053216 4:174893083-174893105 TAGCTATGATGTCAGCTGTAGGG - Intronic
984114984 4:175668921-175668943 TAATCATGAGGTTAGCGGCATGG + Intronic
984636653 4:182118396-182118418 GAAGTATAATGTTAGCTGTAGGG + Intergenic
1202760916 4_GL000008v2_random:109714-109736 TGAGTATGATGTTAGCTGTGAGG + Intergenic
985990441 5:3554876-3554898 TAAGTATGATATTAGCTGTAGGG - Intergenic
986538678 5:8819966-8819988 TAAGTATAATATTAACTGTAGGG + Intergenic
986951734 5:13096015-13096037 TAAGTACGATGTTAGGTAGAGGG - Intergenic
986991674 5:13560807-13560829 TAAGTACAATGTTAGCTGTAGGG - Intergenic
987141355 5:14950076-14950098 TAAGTATGATCTTTGCTATATGG + Intergenic
988034206 5:25804284-25804306 TCAGTATGATGTTGGCTGTGAGG + Intergenic
988612726 5:32742691-32742713 TAAGCATGATGTTTGCTGTGGGG + Intronic
988819792 5:34870984-34871006 TAAGCATGAAATCAGCTGCAGGG - Intronic
989139260 5:38186888-38186910 TGAGTATGATGTTAGCTGTGGGG - Intergenic
989461897 5:41709210-41709232 TAAGTATGATGTTAGCTGTAGGG + Intergenic
989490334 5:42044829-42044851 TAAATATGATGTTAGCTGTGGGG - Intergenic
989897059 5:47103723-47103745 TCAGTATGATGTTGGCTGTGGGG + Intergenic
990063825 5:51687024-51687046 TAAGTCTCTTATTAGCTGCATGG - Intergenic
990858156 5:60295454-60295476 TAATTATGATGTGAGCTGTTGGG + Intronic
990930432 5:61084079-61084101 TAGGTATGATATTAGCTGTAAGG + Intronic
990980911 5:61601946-61601968 TAAGTATGATGTTATCAGTGAGG + Intergenic
991007995 5:61850256-61850278 TAAATATGATGTTAGCTGTGGGG - Intergenic
991140641 5:63237582-63237604 TAAGTATGATGTTTGCTGTGGGG - Intergenic
991299673 5:65117879-65117901 TAAATATGATGTTAAGTGTAAGG + Intergenic
991629480 5:68641368-68641390 GAAGTATGATGTTAGCTGTAGGG + Intergenic
992161034 5:74002183-74002205 TAAATATGATATTAGTTGTAGGG + Intergenic
992861009 5:80909740-80909762 TAAGAATGATGTTAGCGGCTAGG - Intergenic
993762372 5:91811150-91811172 TAAGTACAATGCTAGCTGAAGGG - Intergenic
994708719 5:103239288-103239310 TAAATATAATGTTAACTGTAGGG - Intergenic
995064800 5:107848174-107848196 TAAGTATGATCGTAGCTGTAGGG - Intergenic
995382302 5:111548664-111548686 TAATTATCATGTAATCTGCAAGG - Intergenic
996267497 5:121559292-121559314 TATGTACTATGTTAGCTGTAGGG - Intergenic
996468594 5:123832854-123832876 CAAGTATGATGTTAGGTGTGGGG + Intergenic
997166836 5:131669784-131669806 TAAGTATGTTGTTAGTTGTAAGG - Intronic
997406393 5:133651345-133651367 TAAGTATGATGTTAGCTATAGGG + Intergenic
998190001 5:140015606-140015628 TAAGTATCCTGTTTCCTGCATGG + Intronic
999006746 5:147988867-147988889 TGAGTATGATGCTAGCTGTGGGG + Intergenic
999508330 5:152221607-152221629 CAAGTATGGTGTTAGGTGCCAGG - Intergenic
999549230 5:152666539-152666561 TAAGGATGATGTCAGCTGTGGGG - Intergenic
1000498872 5:162022104-162022126 TCAGTATGATACTAGCTGAATGG - Intergenic
1001478877 5:172072647-172072669 TAAGTATGATGCTAGCAATAGGG - Intronic
1001538484 5:172518492-172518514 TACATATGATATTAGCTGTAGGG - Intergenic
1001842492 5:174890831-174890853 TAAATATGATGTTAGTTGTAGGG + Intergenic
1002657656 5:180764201-180764223 TACATATGATGTTAGCTTTAGGG + Intergenic
1202772670 5_GL000208v1_random:25928-25950 TCAGTATGATGTTGGCTGTGGGG + Intergenic
1002936241 6:1675554-1675576 CAAGTATAATGTTAGCTGGCTGG + Intronic
1003027831 6:2572812-2572834 TAAGTATATTGTTAGCTGTAGGG + Intergenic
1003198392 6:3935458-3935480 TTAGTATGAGGTTAGCTGTAGGG + Intergenic
1003313522 6:4990046-4990068 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1003335495 6:5168088-5168110 TAAGTATCATGATAGATTCATGG - Intronic
1003418671 6:5936443-5936465 TAAGGATGAAGTTAGCTGATAGG - Intergenic
1003597237 6:7484958-7484980 TAAGTATAATGTTAGCAGTGGGG + Intergenic
1003719929 6:8690780-8690802 TAAGTATAATGCTAACTGTAGGG + Intergenic
1003779418 6:9406360-9406382 TAAGCATTATGTTTGGTGCATGG - Intergenic
1003907292 6:10713734-10713756 TAAGTATAATGCCAGCTGTAGGG + Intergenic
1003986432 6:11440453-11440475 TAAGTTTGATGTTAGTTCTAGGG + Intergenic
1004860481 6:19800132-19800154 TAAGTATAATATTAGTTGTAGGG - Intergenic
1005228226 6:23668163-23668185 TAAGTATAATGTTGGCTGCAGGG + Intergenic
1006487443 6:34355139-34355161 TAAGTATGATATTAGCTGTTTGG + Intronic
1006747558 6:36355195-36355217 TAAGTAGGATGGTAGCTGTGGGG + Intronic
1007456384 6:41980907-41980929 TGAGTATGATGTTAGTTGTAGGG - Intronic
1007854685 6:44843281-44843303 TAAGACTGATGTTAGCTGTGGGG - Intronic
1008073861 6:47125682-47125704 TGAATATGATGTTAGCTGTAGGG + Intergenic
1010137184 6:72569400-72569422 TAAGTATGATTTTTGCTATAGGG - Intergenic
1010776613 6:79893972-79893994 TAAGTATGCAGTTGGCTCCAAGG - Intergenic
1011924912 6:92630270-92630292 TAAGCATGATGTTAGCTGTTAGG + Intergenic
1012415370 6:99007071-99007093 TCAGTATGATGTTGGCTGTAGGG - Intergenic
1012759730 6:103283378-103283400 TAAGTATGATGTTAGCTGTTGGG + Intergenic
1012782019 6:103572574-103572596 TAAGTATGGTGTTAGCTGTATGG + Intergenic
1012806350 6:103898574-103898596 TAAGTATAATATTAGCTATAGGG - Intergenic
1013144799 6:107378149-107378171 TAAGTATGATATTGGCTATAGGG - Intronic
1013445447 6:110221516-110221538 TAAGAAAGATCTTAGCTGTAAGG - Intronic
1013863877 6:114670478-114670500 TAAGTACGATGTTAATTGTAGGG + Intergenic
1013971304 6:116022687-116022709 TGAGTATGATGTTAGGTGAAGGG - Intronic
1014102421 6:117526681-117526703 TTAGAATGATTTTATCTGCAAGG + Intronic
1014488367 6:122029927-122029949 TGAGTATGAAGTGACCTGCAAGG - Intergenic
1014958044 6:127646271-127646293 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1014961008 6:127684763-127684785 TAAGTATAATGTTAACTGTAGGG + Intergenic
1015096690 6:129423213-129423235 TAAGTATGATTTTAGCTGTTAGG - Intronic
1015234525 6:130955359-130955381 TTAGTATGTTGTCATCTGCAAGG - Intronic
1015324911 6:131913954-131913976 GAAGAATGATGTTAGCTGTAGGG + Intergenic
1015331691 6:131987429-131987451 TAATTATGATGTTTACTGTAAGG + Intergenic
1015336776 6:132048197-132048219 TGAGTATGATATTAGCTGTGGGG - Intergenic
1015556909 6:134472063-134472085 TAAGTATGCTGGTAGCAGAATGG + Intergenic
1015668079 6:135654123-135654145 TAAGTCTTATGTTAGTTGTAGGG - Intergenic
1015768212 6:136741522-136741544 TAAGTATGATGTTAGCTATAGGG - Intronic
1016048544 6:139505654-139505676 TAAGTATTATATTAACAGCAAGG - Intergenic
1016115880 6:140285396-140285418 TTAGGAAGATGTTAGCTACAAGG + Intergenic
1016601827 6:145870763-145870785 TAAATATGATGTTAGCTGTAGGG + Intronic
1017487070 6:154913183-154913205 TAAGTAGGATTTTAGTTGAAGGG - Intronic
1018863246 6:167727574-167727596 TAAGTGTGATGTTAGCTGTAGGG - Intergenic
1019169136 6:170119918-170119940 TAAATATGAAGTTATCTGTAGGG + Intergenic
1020093572 7:5355127-5355149 TAAGTTTGTGGCTAGCTGCAGGG - Intronic
1020547021 7:9545025-9545047 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1021793796 7:24232963-24232985 GGAGTAGGATGTTAGCTGTAGGG - Intergenic
1022277266 7:28867518-28867540 TAGGCATGATGTTAGGTGCTGGG + Intergenic
1022900513 7:34804552-34804574 TAAATATGAGGTTAACTGTATGG - Intronic
1023979345 7:45058300-45058322 TAAGTATGATGTTCGCTTTAGGG + Intronic
1024016691 7:45323460-45323482 GAGCTATGATGTTAGCTGCTTGG + Intergenic
1024122185 7:46255354-46255376 TAAGTATGATGTTAACTGTAGGG - Intergenic
1024185425 7:46943898-46943920 TAAGTATCAAGTCAGCTACAAGG - Intergenic
1024437215 7:49372343-49372365 TTAGTGTGAGGTTAGCTGCGGGG + Intergenic
1024489301 7:49959127-49959149 TAAGTATGGTATTAGCTGTAGGG - Intronic
1025712001 7:63920459-63920481 TCAGTATGAGGTTAGATGCAGGG - Intergenic
1026237663 7:68542208-68542230 TAGATATCATGTTAACTGCATGG - Intergenic
1027551565 7:79603717-79603739 CAAGTATAATGTTAGCTGTATGG + Intergenic
1027937074 7:84620374-84620396 TAATTATAATGTTAGCTATAGGG + Intergenic
1028391885 7:90326434-90326456 TAAGAAAGATGTTTGCTGTAGGG - Intergenic
1028926655 7:96364616-96364638 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1030402442 7:109069103-109069125 TATGTATATTGTTAGCTGCATGG + Intergenic
1030798353 7:113817647-113817669 TAAGTATGAAGCTAGCTACACGG + Intergenic
1031112973 7:117633609-117633631 TAAGTATGATTTTAGCTGGAGGG + Intronic
1031408785 7:121418034-121418056 TGAATATGATGTTAACTGTAGGG + Intergenic
1031819956 7:126488042-126488064 AAAGTATGATGGTTGCTTCAAGG - Intronic
1032418011 7:131753596-131753618 TAAATATAATATTAGCTGTAGGG + Intergenic
1032935479 7:136725902-136725924 TAAGTATGATGTTGGCTGTGGGG - Intergenic
1033268344 7:139907148-139907170 TAAGTATGACATTAGCTGTAAGG + Intronic
1035149641 7:156858932-156858954 TAAGTATGATGTTAGCTGTGGGG - Intronic
1035580111 8:734495-734517 TTAGTATGCTGTTAGCTCTAGGG - Intronic
1035612306 8:975759-975781 GAAGTATGAGTTTAGCTACAGGG - Intergenic
1035835462 8:2746676-2746698 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1035992961 8:4512319-4512341 TAAGTAAAATGTTAGCTGCAGGG - Intronic
1037358159 8:18044923-18044945 TAAGTATGATATTAGCTGTATGG + Intergenic
1037508738 8:19560110-19560132 TAAGTAGAATGTAACCTGCACGG + Intronic
1037956191 8:23061647-23061669 TGAGTATGATGTTAGCTGTGGGG + Intronic
1038786462 8:30621936-30621958 TAAGTATGATGTTAAATCTAGGG + Intronic
1039015378 8:33142371-33142393 TTAGTATGATGTTGGCTACGAGG - Intergenic
1039196449 8:35036766-35036788 TAAGTATGATGCTAGTTGTTTGG - Intergenic
1039340358 8:36642249-36642271 TAAGCATAATGTTAGCTGTAAGG - Intergenic
1039656784 8:39418485-39418507 TCAGTATGATGTTAACTGTGGGG - Intergenic
1039660606 8:39459516-39459538 TAAGTATGATGGTAGCTGTAGGG - Intergenic
1039668707 8:39568982-39569004 CAAGTCTGATGCTAGCTGTAGGG + Intergenic
1040420305 8:47233438-47233460 TAAGTATAATGTTAGCTGTAGGG - Intergenic
1040446182 8:47496309-47496331 TAAGTCTGATGTTAGTTGTAGGG + Intronic
1040534222 8:48293029-48293051 TAAGTATAATGTTAGCCTCAGGG + Intergenic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1040672433 8:49708183-49708205 AAAGTATGATATTATCTGTAGGG + Intergenic
1040744430 8:50623282-50623304 TAAGTGTGATGGTAGCTGTGGGG + Intronic
1041188068 8:55323008-55323030 TCAGTATGATGTTTTCTGTAAGG + Intronic
1041474850 8:58252847-58252869 TAAGAATGATGTTAGTTGTAGGG - Intergenic
1041612231 8:59864197-59864219 TAAGTATGAAGGTAGCAACATGG + Intergenic
1042211438 8:66385021-66385043 TAAGTATGATTCCATCTGCATGG - Intergenic
1042366627 8:67944387-67944409 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1042394429 8:68276165-68276187 TAAGTCTGATGCTAGCTGTAGGG + Intergenic
1042538356 8:69882219-69882241 TAAGTATCGTGTTAGCTCTAGGG - Intergenic
1042759998 8:72260878-72260900 TCAGTGTGATATTGGCTGCAGGG - Intergenic
1043066754 8:75581695-75581717 TAAATATGAGGTTAGTTGCAAGG - Intergenic
1043650924 8:82590925-82590947 TAAATATAAAGTTAGCTGAAGGG - Intergenic
1044435241 8:92154309-92154331 TCAGTATGATGTTTGTTGCATGG + Intergenic
1044620155 8:94182641-94182663 TAAGTACAATGTTAGCTGTGGGG - Intronic
1044935415 8:97289169-97289191 TTAGGATGATGTTTGCTGAACGG + Intergenic
1045064977 8:98436591-98436613 CAAGTACCATGTTAGATGCAAGG + Intronic
1045080594 8:98621511-98621533 TAATTATGATGTTAGCTGAAAGG + Intronic
1045118518 8:99010929-99010951 TAAGTATGTTGTTAGCTGTAGGG - Intergenic
1045827812 8:106421455-106421477 TAAGCCTGTGGTTAGCTGCAGGG + Intronic
1045874082 8:106958647-106958669 TAAGTATAATGTTAACTGTGAGG + Intergenic
1046557936 8:115799230-115799252 TAAGTATGATTTTAGATGCAGGG - Intronic
1046682790 8:117190706-117190728 TAACTATGATGTTAGCTGTGGGG - Intergenic
1047871607 8:129088993-129089015 TAAGTAATATGTTAGGTGTAGGG + Intergenic
1048109028 8:131446294-131446316 TAAATATGATATTAGCTGTTAGG + Intergenic
1048389604 8:133949199-133949221 TAAGTATGATATTAACTGTGTGG - Intergenic
1048598365 8:135891060-135891082 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1048642618 8:136381032-136381054 TAAGTATAATGGTACCTGTAAGG - Intergenic
1048673148 8:136746303-136746325 TGTGTATAATGTTAGCTGTAGGG + Intergenic
1050542143 9:6679904-6679926 TAAGTAGGATGTTTGGTGTATGG + Intergenic
1050649399 9:7758843-7758865 TAAATAAAATGTTTGCTGCATGG + Intergenic
1050890341 9:10817493-10817515 TAAGTATAATATTAGCTGTAGGG + Intergenic
1051778159 9:20658800-20658822 TAAGAATGGAGTTAGTTGCAGGG - Exonic
1052471655 9:28904243-28904265 TAAGTGTTATGTTAGCTGTGGGG - Intergenic
1052647997 9:31262395-31262417 TAAATATGAAGTTATATGCAGGG - Intergenic
1052839686 9:33281793-33281815 TAAGTACCTTGTTAACTGCAAGG + Intronic
1054703776 9:68441628-68441650 TAAATATGATTTTAGCTGTAGGG - Intronic
1055536783 9:77255105-77255127 TGAGTATGATGTCAGCTGTGGGG + Intronic
1055562926 9:77539122-77539144 TCAGTATGATGTCAGCTGTGAGG + Intronic
1055863239 9:80780623-80780645 TCAGTACAATGTTAGCTGTAGGG + Intergenic
1056375455 9:86005367-86005389 TAAGTATGATGTTAGCTGTAAGG - Intronic
1056594057 9:87990732-87990754 TAAGTAGGATGTTACTTGTAGGG + Intergenic
1056997222 9:91474058-91474080 TATGTATCATGTTAGTTGTAGGG + Intergenic
1057288457 9:93780919-93780941 TAAGGATGATGTTAGCTGTAGGG + Intergenic
1058006835 9:99924883-99924905 TAAGTATGGTGTTAAATGTAGGG + Intronic
1058361038 9:104146225-104146247 GAAGTGTAATGTTAGCTGTAAGG + Intergenic
1059024449 9:110610512-110610534 TAAGTATGTTGAAAACTGCAAGG - Intergenic
1059397438 9:114046650-114046672 TAAGCATGATGTTCGCTGTGGGG + Intronic
1060323094 9:122584338-122584360 AGAGTATGATGTTAGCTGTGAGG - Intergenic
1060590801 9:124815485-124815507 TAAGTACGCTGTTAGCTGAATGG + Intergenic
1062019613 9:134311998-134312020 TAAATATGATGTTTGCTGTCAGG + Intergenic
1062704359 9:137927726-137927748 TAAGTATAATGTTAGCTGTACGG + Intronic
1062719538 9:138030174-138030196 TTAGTATGATATTAGCTGTAAGG + Intronic
1185775391 X:2799094-2799116 TAACTTTGATGTTAGGTTCAGGG + Intronic
1187620277 X:21045291-21045313 TCAGTATGATATTGGCTACAGGG + Intergenic
1187637523 X:21247555-21247577 GAAGTATGACGTTAACTGTAGGG - Intergenic
1187780824 X:22821627-22821649 CAAGTACAATGTTAGATGCAGGG + Intergenic
1187788210 X:22917660-22917682 TATGTAGAATCTTAGCTGCAAGG + Intergenic
1188870980 X:35371465-35371487 TAAGTATTATGTTAGTTGTATGG + Intergenic
1189426187 X:40903406-40903428 TAAGTATTATATTAACTGTAGGG - Intergenic
1189527554 X:41840691-41840713 TAAGTAAGATGTTAGCTGTAGGG + Intronic
1189566981 X:42252569-42252591 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1189575300 X:42345058-42345080 TAAGTATGATGTCAGCTGTAAGG + Intergenic
1189654571 X:43229686-43229708 TAAGTATAATGTTAGGTGTAGGG - Intergenic
1189670017 X:43398477-43398499 TAAGTATGATGTTAGCTGTGGGG - Intergenic
1189741996 X:44128427-44128449 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1189770407 X:44419822-44419844 TGTGTATGATGTCAGCTACAGGG - Intergenic
1189805425 X:44730368-44730390 TAAATATGATGTTAGCAGTCTGG - Intergenic
1190011208 X:46786560-46786582 TAAGTATGATGTTATCTATAGGG + Intergenic
1190033948 X:47002912-47002934 TAAGTATGATATTAACTATAGGG + Intronic
1190140434 X:47838417-47838439 TAAGTATGATTTTAGCTGTAGGG + Intronic
1190402492 X:50052138-50052160 TAACTGTGATATTAGCTGTAGGG + Intronic
1190469075 X:50758326-50758348 TAAGTATGATGCTACCTGTAAGG + Intronic
1190625490 X:52334226-52334248 TAAGAATAATGTAAGCTGTAGGG + Intergenic
1191042399 X:56097830-56097852 TATGTATGATGTTAACTGTAGGG - Intergenic
1191162902 X:57352491-57352513 TTAGTATGATGTTACCTGGTGGG - Intronic
1191703035 X:64063757-64063779 TAAGTATGATATTAGTTGTAGGG + Intergenic
1191749835 X:64529971-64529993 TAAGTATGATGTTAGCTGTCAGG - Intergenic
1192187904 X:68966012-68966034 TAATTATGATGTTAGCTATAGGG + Intergenic
1192332591 X:70188996-70189018 CAAGTGTGATGTTAACTGTAGGG - Intronic
1192384716 X:70655872-70655894 TAAATATGATGTTTGCTTTAGGG - Intronic
1192548535 X:72033998-72034020 TAAGTTTAATGTTAGCTGTAGGG + Intergenic
1192700849 X:73470086-73470108 TTAGTATGATGTTTGCTGTGGGG + Intergenic
1192862503 X:75091471-75091493 TAAGTATGTTGTTAACTTTAAGG - Intronic
1192903832 X:75528182-75528204 TAAACATGATGTTAGTTACAGGG + Intergenic
1193097658 X:77569158-77569180 TAACTATGATGTTAGCTGTAAGG - Intronic
1193293988 X:79811906-79811928 TAAGTATAATGTTAGATGTAGGG + Intergenic
1193382288 X:80828793-80828815 GAAGTATTATGTTAGCTGTGGGG - Intergenic
1193561306 X:83020762-83020784 TGAGTATGAGGTTAGCTGTGGGG - Intergenic
1193853736 X:86572637-86572659 TGAGTATGATGTTGGCTATAGGG + Intronic
1194113057 X:89860581-89860603 TAAGTGTAATATTAGCTGCGGGG + Intergenic
1194391514 X:93322994-93323016 TAAGTATGATATTAGCTGTGGGG - Intergenic
1194426346 X:93743044-93743066 TAATTATAATGTTGACTGCATGG + Intergenic
1194848643 X:98843916-98843938 TTAGTATGATGTTAACTGTGGGG + Intergenic
1195059646 X:101181895-101181917 TAAGTATGATATCAGCTGTTAGG + Intergenic
1195589254 X:106604830-106604852 TAAGCATGATGTTAACTGTACGG - Intergenic
1195631596 X:107061265-107061287 TAAGTAAGATGTTAGCATTAGGG + Intergenic
1195633204 X:107082125-107082147 TAAGTATAATGTTAGCTGTAGGG + Intronic
1195930979 X:110075571-110075593 TCAGTATGATGTTGGCTGTGGGG + Intronic
1195957692 X:110350327-110350349 TAAGTATGATGTTATCTGTTGGG - Intronic
1196076374 X:111581349-111581371 TAAGTATGATGTTAGTGGTGGGG + Intergenic
1196913099 X:120504155-120504177 TAACTGTGATGTTAGTTGTAGGG + Intergenic
1197062509 X:122198149-122198171 TGAGTATGATGTTATCTGTGGGG - Intergenic
1197109088 X:122750978-122751000 TGGGTATGATGTTAGCTGTGGGG + Intergenic
1197279169 X:124515226-124515248 TCAGTATGATGTTGGCTGTGGGG - Intronic
1197450662 X:126611592-126611614 TAAGTGTGCTGTTAGCTGTAGGG - Intergenic
1197539414 X:127738054-127738076 TAAGTATGATGCTAGCTATAGGG - Intergenic
1197568942 X:128125298-128125320 TGAGTATGATGTTAGCTGTTAGG - Intergenic
1198220353 X:134594016-134594038 TAAGTAAAATGTTAGTTGTAGGG + Intronic
1198420080 X:136462710-136462732 TATATATGATGTTAGCTGTGAGG + Intergenic
1198446369 X:136720539-136720561 TAAGTATGATGTTAGATGTCGGG - Intronic
1198612316 X:138415849-138415871 TAAGTTTTATTTTAGCTTCAGGG + Intergenic
1198699083 X:139377245-139377267 AAAATATGATGTTAGCTACAAGG + Intergenic
1198930420 X:141852545-141852567 TGAGTATCATGTTAGCTGCAGGG + Intronic
1199311266 X:146322947-146322969 TAAGTATGATATGAGCTTTAGGG - Intergenic
1199550313 X:149054645-149054667 AAAGTATGATGTTACCTACTGGG + Intergenic
1200465708 Y:3515411-3515433 TAAGTGTAATATTAGCTGCTGGG + Intergenic
1201294523 Y:12452305-12452327 TAACTTTGATGTTAGGTTCAGGG - Intergenic
1202386468 Y:24331320-24331342 GAAGGATGATGTGAGCAGCAAGG - Intergenic
1202484318 Y:25338808-25338830 GAAGGATGATGTGAGCAGCAAGG + Intergenic