ID: 1100349179

View in Genome Browser
Species Human (GRCh38)
Location 12:93762492-93762514
Sequence GTAAAGGCCTCATGGGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100349179 Original CRISPR GTAAAGGCCTCATGGGCAAT AGG Intronic
904897426 1:33827408-33827430 GGAAAGGCCTTTTGGGGAATTGG - Intronic
920963853 1:210686185-210686207 CTAAAGGCCTCATGGGGGATGGG + Intronic
1063377198 10:5561455-5561477 GTAAAGGGCTCCGGAGCAATGGG + Intergenic
1065600094 10:27359260-27359282 GTAAAGGGCTCTTGGGCCAGAGG + Intergenic
1069350476 10:67520309-67520331 GTAAATGCCTCAGGGGCAGAAGG - Intronic
1074837512 10:117312016-117312038 GTAAAGCACTGATGGGAAATAGG - Intronic
1076274664 10:129186955-129186977 GCAAAGGCCTCATAAGCCATAGG + Intergenic
1077873911 11:6287190-6287212 ATAAAAGCCCCTTGGGCAATTGG + Intergenic
1080145949 11:28984188-28984210 GGGAAGGTCTCAAGGGCAATGGG + Intergenic
1087019719 11:93589868-93589890 TTAAAGGACTCTTGGGCAACAGG - Intergenic
1087264160 11:96042636-96042658 GAAAAGGCTTCATGGGGAACAGG - Intronic
1087949332 11:104201086-104201108 GTAAATGCCTAATGAGCAGTGGG + Intergenic
1089600100 11:119608816-119608838 GGAAAGGCTTCCTGGGAAATTGG + Intergenic
1090771049 11:129920260-129920282 GGAAAGGCCTCATGGAGATTTGG - Intronic
1090887619 11:130893085-130893107 GTAAAGCCCCCATGAACAATAGG - Intronic
1095849611 12:46787966-46787988 GTAATGCCATCATGGGCAGTGGG - Exonic
1097338108 12:58407169-58407191 GTAAAGGGCTCATAGGCTATGGG + Intergenic
1098463846 12:70764481-70764503 CAAAAGGCATCATGGGCAATGGG + Intronic
1098808944 12:75059289-75059311 GAAAAGGCCTCATGGCTACTAGG - Intronic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1100349179 12:93762492-93762514 GTAAAGGCCTCATGGGCAATAGG + Intronic
1100688063 12:97008330-97008352 GTATAGACTTCATGGGCAATAGG - Intergenic
1101232399 12:102754819-102754841 GTAAATGACATATGGGCAATGGG - Intergenic
1104218983 12:126763595-126763617 GAAAAGGACTGATGGGCACTGGG - Intergenic
1107290669 13:38849579-38849601 GTATAGGGCTCATTGACAATAGG - Intronic
1107534975 13:41320439-41320461 GTAATGGCCACATGGGAAAGGGG - Intronic
1117229557 14:53701761-53701783 GTAAAGGTCCAATGGGCCATAGG - Intergenic
1119288897 14:73478909-73478931 GTGAAGGCCTCTTTGGCTATAGG + Intronic
1120062799 14:80003943-80003965 GAACAGGCCTCATGAGCTATGGG - Intergenic
1128040847 15:64572122-64572144 GCAAAGGCCTGAGGGGAAATGGG + Intronic
1130609472 15:85347766-85347788 GTAATGGCCTCATGGAAAAAGGG + Intergenic
1134413212 16:14020730-14020752 GTTAAGGGCTCATTGGCAACAGG - Intergenic
1134536114 16:15028085-15028107 GTGCAGGCCTCATGGGGCATGGG - Intronic
1138221649 16:55256670-55256692 GTAATGGCCACATGGGTTATTGG + Intergenic
1142467694 17:145596-145618 GGAAAGGCCTGATGGGCACTTGG + Intergenic
1148586190 17:48782475-48782497 GAAAAGGCAACTTGGGCAATGGG - Intronic
1151341265 17:73472407-73472429 GCAAAGGCCTCATTGGCTTTGGG - Intronic
1152680883 17:81667154-81667176 GGAAAGGCCTCCTGGGCTTTCGG + Intronic
1153992274 18:10411059-10411081 GCAAAGACCTCCTGGGCAGTAGG - Intergenic
1155751400 18:29426977-29426999 GTCAAAGTCTCATGGGGAATAGG + Intergenic
1160963623 19:1735896-1735918 TGAAGGGCCTCATGGGCAAGAGG + Intergenic
1163772415 19:19199016-19199038 TCAAAGGCCACATGGGCAACGGG + Intronic
1164058454 19:21643386-21643408 GAAAATGCCTCATAGGAAATGGG - Intergenic
1164470579 19:28527669-28527691 ATAAAAGCCTCATGGGAAACTGG + Intergenic
1164628481 19:29745414-29745436 GGAAGGGCTTCATGGGCAGTGGG + Intergenic
926466770 2:13200689-13200711 GTAACTGCCTCATGGGGAAAAGG - Intergenic
926583376 2:14656832-14656854 GGAAAGGACTCATGGGAAGTGGG + Intergenic
937248658 2:120510142-120510164 TTAAAGGCCTCATGGTCCAGTGG - Intergenic
938569955 2:132553828-132553850 GTAAAGGACTCATGCTCACTGGG - Intronic
943589140 2:189776752-189776774 GGAAAGGACTCATGTTCAATTGG + Intronic
945586049 2:211664423-211664445 GAAAAGGCTTTATGGGCAGTAGG + Intronic
947088132 2:226478510-226478532 TTAAGGGCCTCATGGGCACAGGG + Intergenic
947701782 2:232240451-232240473 GTAACTGTGTCATGGGCAATAGG + Intronic
1170255187 20:14334635-14334657 GTGAAGGCCTCTGGGGCAAAAGG + Intronic
1171782204 20:29429375-29429397 GTAAAGGCATTATAGGAAATGGG + Intergenic
1178937189 21:36873712-36873734 GTTCAGGCCTCCTGGGCAACTGG + Intronic
1183601986 22:38845033-38845055 GGAAAGACCTCATGGAAAATTGG - Intergenic
950024853 3:9813182-9813204 GTTGAGGCCTTATGGGCTATGGG + Intronic
953025355 3:39141923-39141945 GGCAAGGCCTCCTGGGCAAGGGG + Exonic
955090459 3:55745268-55745290 GGAAAGGCCACGTGGGAAATAGG + Intronic
956902989 3:73736142-73736164 GTACAGACCTGATTGGCAATTGG + Intergenic
956963520 3:74431645-74431667 GAAAAGGCCACATGTGCAATTGG + Intronic
961131013 3:124467469-124467491 GGAAAGGCCTCATGGAGAAGGGG + Intronic
961319493 3:126063127-126063149 GTGAAGGCATAATGGGCAGTGGG - Intronic
967284491 3:187855098-187855120 GTAAAGGGATCATGGTCAAATGG - Intergenic
974805930 4:66881096-66881118 TTAAAGGCCCCATAGCCAATGGG + Intergenic
979645904 4:123068339-123068361 GCAAAGGCCGTATGGGTAATAGG + Intronic
980014244 4:127630408-127630430 GTAAAGGGGTAATGGGCAAAAGG - Intronic
986921654 5:12691213-12691235 AAAAAGGCCTGATGTGCAATGGG + Intergenic
994505404 5:100637502-100637524 GGAAAGGGCTGATGGGCAAAGGG - Intergenic
998609144 5:143668944-143668966 GTAAAGGCCTGAGGCGAAATTGG + Intergenic
1000455352 5:161442148-161442170 GTAAACACATTATGGGCAATGGG - Intronic
1005434282 6:25791792-25791814 GTCACAGCCACATGGGCAATGGG - Intronic
1007110639 6:39311725-39311747 GCAGAGGCCTCATGGAGAATGGG + Intronic
1008144699 6:47877340-47877362 GTAAAGCGCTCATTTGCAATTGG + Intergenic
1011047986 6:83107953-83107975 TTAAAGTCCACATTGGCAATGGG + Intronic
1014201206 6:118610607-118610629 GCAAAGGCCTCACAGGAAATTGG + Intronic
1015444617 6:133288567-133288589 GTGAAGGCCTGCTGGGCCATGGG + Intronic
1020477931 7:8620815-8620837 TTAAAGGCCTCATGGGGACAAGG + Intronic
1023139037 7:37082844-37082866 ATAAAGGGCTCCTGGGGAATAGG - Intronic
1026861093 7:73789912-73789934 ATAAAAGCCCCATGGGGAATCGG + Intergenic
1028049683 7:86167576-86167598 GTATAGGCCTCAGGGGTAAAAGG + Intergenic
1028821632 7:95218359-95218381 GTAAAGCCCTCCTGAGCAAATGG - Intronic
1031950875 7:127890955-127890977 GGCAATGCCTCATGGGCAAAGGG - Intronic
1032398853 7:131609978-131610000 GGAAAGACTTCATGGGCAAAGGG + Intergenic
1037507015 8:19540763-19540785 GGAAAGGCTTCCTGGGCAAAGGG - Intronic
1040765709 8:50908319-50908341 GAAAATGCCTGATAGGCAATTGG + Intergenic
1042617243 8:70663384-70663406 GTAATGGCCTCATAGCCCATTGG + Intronic
1050216927 9:3337068-3337090 GTAAAGGCCTTATGGGTAGGAGG + Intronic
1055777808 9:79784821-79784843 GTAAATGCTTTATGGGCAATTGG - Intergenic
1186747142 X:12581857-12581879 GGAAAGGCCTCATGAGAAAATGG - Intronic
1188493027 X:30756008-30756030 GTGCAGGCCTCATGTGCACTGGG + Intergenic
1195378449 X:104249869-104249891 GTAAACCCATCATGGGCACTTGG + Intergenic
1195544685 X:106101177-106101199 GGAAAGGCATCGAGGGCAATTGG - Intergenic
1196075259 X:111569035-111569057 AGAAAGGCCTCAGGGGCCATAGG - Intergenic
1197694201 X:129533422-129533444 TTAGAGGCCTGATGGGCAGTTGG - Intergenic
1198129031 X:133675648-133675670 GGAAAGGCCCCAGGGGCAACAGG - Intronic
1202380601 Y:24273901-24273923 GTAATGGCCTCATGGAAAAAGGG + Intergenic
1202490183 Y:25396224-25396246 GTAATGGCCTCATGGAAAAAGGG - Intergenic