ID: 1100354758

View in Genome Browser
Species Human (GRCh38)
Location 12:93818624-93818646
Sequence AAATATCTGCAGAGGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100354750_1100354758 16 Left 1100354750 12:93818585-93818607 CCAGTTGGCAGAGGAGGCATGCA 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1100354758 12:93818624-93818646 AAATATCTGCAGAGGGGGCAAGG 0: 1
1: 0
2: 2
3: 28
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100354758 Original CRISPR AAATATCTGCAGAGGGGGCA AGG Intronic
902109772 1:14068474-14068496 AAAAGTCTGCAGTGGGGCCAGGG + Intergenic
902111575 1:14083094-14083116 TAATGTCTGAAGAGGTGGCAGGG - Intergenic
903037215 1:20500632-20500654 AAATCCCTGAAAAGGGGGCAGGG + Exonic
906759368 1:48360717-48360739 AATAGTCTGCAGAGGGGCCAAGG + Intronic
907113845 1:51951291-51951313 AAATGTCTGCATTGGGGACAAGG - Intronic
909020516 1:70426066-70426088 AAACAAATGCAGAGGGGGCTAGG - Intronic
910728058 1:90359636-90359658 AAATCTTTCCAGTGGGGGCAAGG - Intergenic
913157527 1:116114684-116114706 CAAAATCTGCAGATGGGACAGGG - Intronic
915994105 1:160546717-160546739 AAATACCTTATGAGGGGGCAGGG - Intronic
918292833 1:183125519-183125541 TACAATCTGCAGAGTGGGCAAGG + Exonic
919292455 1:195650010-195650032 AGATATCTGCACAGGGAGCATGG + Intergenic
919932475 1:202230275-202230297 TAATATCTCCAGATCGGGCAGGG - Intronic
920915313 1:210253787-210253809 GCTTTTCTGCAGAGGGGGCAGGG + Intergenic
922607627 1:226900362-226900384 AATTGTCCACAGAGGGGGCAGGG - Intronic
923098178 1:230792248-230792270 AAATCTCTGAAGAGGGGAAACGG - Intronic
924248727 1:242109579-242109601 ATCTAACTGGAGAGGGGGCAAGG - Intronic
1063464822 10:6236308-6236330 GCATCTCTGCAGATGGGGCAGGG + Intergenic
1063771112 10:9201851-9201873 ACATATCAGCAGCGGGGCCAGGG + Intergenic
1064042233 10:11977192-11977214 AAATAGTTGCAGCGGGGGGAGGG + Intronic
1065358710 10:24868698-24868720 AAATATCTGCAGTGGATGAAAGG - Intronic
1067196468 10:44123606-44123628 AAATCTCTGCAGGGAGGCCAGGG + Intergenic
1068071320 10:52199693-52199715 AAATATCTGCACTGGGGTCACGG - Intronic
1068630280 10:59290855-59290877 CAGTATTTGCAGGGGGGGCAGGG + Intronic
1069836067 10:71308917-71308939 AAATATTTGAAAAGGTGGCATGG - Intergenic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1070527407 10:77307140-77307162 CAAGATCAGCAGAAGGGGCATGG + Intronic
1072190230 10:93072242-93072264 AAATATCTGCAGAGGTCGGAGGG - Intergenic
1072718216 10:97765522-97765544 AAATGACTCCAGAGGGGCCAGGG - Intergenic
1073330316 10:102666177-102666199 CACTCTCTGCAGAGGGGGCGGGG - Intergenic
1075171825 10:120122546-120122568 AAATCTCTGGAGAAGAGGCATGG + Intergenic
1075537972 10:123287176-123287198 ACATTTCTGCAGAGGAGTCAGGG - Intergenic
1076060145 10:127407706-127407728 GAATGACTGCAGATGGGGCAGGG + Intronic
1076847684 10:133077302-133077324 TAATACCTGAAGTGGGGGCAGGG - Intronic
1078945920 11:16068658-16068680 AAAAATATGCAGGAGGGGCAAGG - Intronic
1082801594 11:57418949-57418971 AAACATCAGCAGAAGAGGCAGGG + Intronic
1082812762 11:57488622-57488644 AAATTTCTTCAGGGTGGGCATGG + Intronic
1083432422 11:62621083-62621105 AAATCTTTGCATAAGGGGCAGGG + Intronic
1085626836 11:78080118-78080140 AAATCTTTCCAGAAGGGGCAGGG - Exonic
1085806486 11:79641559-79641581 AAAAATCTGCAGATGGTGTAAGG - Intergenic
1086391354 11:86367537-86367559 AATGAACTGCAAAGGGGGCATGG - Intergenic
1088751096 11:112842787-112842809 AAGTAGCTGGAGAGGGGGAAGGG + Intergenic
1088969704 11:114762059-114762081 AAATACCTGCTCAGAGGGCATGG + Intergenic
1089108553 11:116035991-116036013 AAATATCAGCAGTTGGGGGAGGG + Intergenic
1090129106 11:124120900-124120922 GAAAATCTGCATAGGGGCCAGGG - Intronic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1091799864 12:3318118-3318140 AGAAATCTGCAGAGAGGGGAAGG - Intergenic
1091992798 12:4970189-4970211 ACCTCACTGCAGAGGGGGCATGG - Intergenic
1092180534 12:6443700-6443722 GAAGAGCTGCAGAGGGGGCTGGG + Intergenic
1092783571 12:12008664-12008686 AAAACTCTACAGAGAGGGCATGG + Intergenic
1094001658 12:25701608-25701630 AGAAATCTGCAGAGGGGGCTGGG + Intergenic
1094490204 12:30956080-30956102 AAATATTTGCAGAGAGTGAAGGG + Intronic
1096115539 12:49052704-49052726 GAAAATCTGCAGAGGGTACAGGG + Exonic
1098489779 12:71061769-71061791 AAAGAACTCCAGAGGGAGCATGG + Intronic
1100354758 12:93818624-93818646 AAATATCTGCAGAGGGGGCAAGG + Intronic
1100686762 12:96995029-96995051 ATATCTCTGCAGAGGGAGGAGGG - Intergenic
1101015614 12:100497143-100497165 AACTGTCAGCAGAGGGGTCAGGG + Intronic
1102007392 12:109597298-109597320 AAACAGCTGGAGAGGGGACAGGG - Exonic
1102040327 12:109796699-109796721 AAAGATCTGCACAGGGGGCCAGG + Exonic
1102219336 12:111183808-111183830 AAATATCTGCAGGGGGTGGTGGG - Intronic
1102749079 12:115276512-115276534 AAATAACTGCTGAAGGGGCAGGG + Intergenic
1103122813 12:118395115-118395137 AAATATCTGGAGAGGGAGAATGG + Intronic
1105070131 12:133229403-133229425 AAAAGTCTGGAGAGGGGGGATGG - Intronic
1105871533 13:24509993-24510015 AAATATCAACAGTGGGGGCTAGG - Intronic
1106596547 13:31145823-31145845 AAATCTCTGTAGAGGAGGCCAGG + Intronic
1108889463 13:55235157-55235179 AAATAGCAGCCGAAGGGGCAAGG + Intergenic
1109721670 13:66283338-66283360 AAATATAGGCAGAGGCTGCATGG + Intergenic
1110966258 13:81701143-81701165 AAATCTCTGCAGATAGGGCTGGG - Intergenic
1116241296 14:42346551-42346573 AAATTTTTGGAGAGGAGGCATGG + Intergenic
1120422255 14:84302931-84302953 AAAAAGCAGCAGAGGGGCCAGGG + Intergenic
1121624488 14:95374358-95374380 AAACCTCTGCGGAGGGGACAGGG - Intergenic
1121636139 14:95455094-95455116 AAATAACAGCAGAGGGGGATTGG - Intronic
1121886300 14:97546153-97546175 ATATCTGTGTAGAGGGGGCAGGG + Intergenic
1121902002 14:97701906-97701928 AAATATTTGCAGAGGTGCCCAGG + Intergenic
1125885069 15:43223025-43223047 AAAGATATGCAGATGGGGCACGG + Intergenic
1127214594 15:56811010-56811032 ATATATCTGCTGATGGGGCTGGG - Intronic
1128117205 15:65116848-65116870 AGATATCTGCTGTGAGGGCAGGG - Intergenic
1128317346 15:66669541-66669563 AAATAAGTGCAGAGGCGGGACGG + Intronic
1132215016 15:100056198-100056220 AAATATAGGCAAAGGGTGCATGG + Intronic
1136177123 16:28524853-28524875 AACTTTCTGGAAAGGGGGCAGGG - Intergenic
1136384355 16:29913797-29913819 AAATAATTCCAGAGAGGGCAAGG + Intronic
1137694332 16:50451232-50451254 AAACATTTGCAGGAGGGGCATGG - Intergenic
1137933768 16:52613761-52613783 GAATCTCTGCAGCAGGGGCAGGG - Intergenic
1138091455 16:54177958-54177980 AAATAGATTCAGAGGGTGCATGG - Intergenic
1138107590 16:54297539-54297561 AAATATCAGCAGAAGTAGCATGG - Intergenic
1139324069 16:66138241-66138263 AAATAACAGCAGAGAGGGCTGGG + Intergenic
1139372528 16:66477823-66477845 AAACATCTGCTCAGTGGGCATGG + Intronic
1139426539 16:66883741-66883763 AAATATCTGCTTCGGGGGCCAGG - Intronic
1139517575 16:67460796-67460818 ATGGATCTGCAGAGGGGGCTGGG - Intronic
1144071870 17:11681422-11681444 AAGTATGTGCAGCGTGGGCATGG - Intronic
1150064565 17:62098235-62098257 AAAAATCTGTAGAGGCGGCCAGG + Intergenic
1151021775 17:70625154-70625176 AAATGTCTGAAGAGGAGGCAGGG - Intergenic
1151033538 17:70771146-70771168 AAATATCTGGAGGCCGGGCACGG - Intergenic
1152688675 17:81707652-81707674 AGATGTCTGCTGAGGAGGCAGGG - Intergenic
1153828766 18:8901052-8901074 AAATACCATCAGATGGGGCAGGG - Intergenic
1154086223 18:11308119-11308141 AACTATCTGGAAAGGGGGCAGGG - Intergenic
1155236596 18:23826053-23826075 ACATATCTGCAGAGGGAAGAGGG - Intronic
1155729220 18:29131139-29131161 AAATAAATTCAGAGTGGGCATGG - Intergenic
1156330270 18:36115144-36115166 AAAAAACTGAAGAGGGGGCCGGG + Intronic
1157412549 18:47475635-47475657 AAAACTCTGAAGAGGGTGCAAGG - Intergenic
1158088509 18:53682741-53682763 CAATTTCTGGAGAGAGGGCAGGG + Intergenic
1159507346 18:69354510-69354532 AAAGAGCTGGAGAGGGGGAAGGG + Intergenic
1159590060 18:70324591-70324613 AAACATCTGGAGAGGCTGCAAGG - Exonic
1160281867 18:77498758-77498780 TAAAGTCTGCAGAGGGAGCATGG - Intergenic
1160480911 18:79238819-79238841 AAATATCTGCAGTGGCCACATGG + Intronic
1160559977 18:79750062-79750084 CAAGATCTGCAGATGAGGCATGG + Intronic
1161206393 19:3043347-3043369 AAAAAGCTGCAGAAGGGGCCGGG - Intronic
1161217468 19:3101543-3101565 AGATGTCTGGAGAGGGGGCCTGG + Intronic
1165340951 19:35211886-35211908 AGATATCATCAGTGGGGGCATGG - Intergenic
1165354431 19:35294963-35294985 AAATATCAGCAGACCAGGCATGG + Intronic
1165415771 19:35692353-35692375 AGATACCTGGAGAGGTGGCAAGG - Intergenic
1166387196 19:42389034-42389056 ACATAGCTGCAGAGGTGGGAGGG + Exonic
1167115716 19:47488061-47488083 AAATAAATGGACAGGGGGCAAGG + Exonic
925146161 2:1584672-1584694 AAATATTGGGAGAGGAGGCAAGG - Intergenic
925634367 2:5928462-5928484 ACAAATCTGCAGTTGGGGCAGGG + Intergenic
926038105 2:9650776-9650798 AAATATATGCAGCGGTGGAATGG - Intergenic
931821359 2:65955377-65955399 ATATATCTCCAGAGGAGGGAGGG - Intergenic
932134754 2:69218569-69218591 GAAGATCTGCAGAAAGGGCAAGG + Intronic
932628262 2:73316310-73316332 AAGTACCTGCAGAGGGATCATGG - Intergenic
933178594 2:79204340-79204362 AAATATCTGCAAAGAGGGACAGG - Intronic
933938566 2:87226657-87226679 AAATGTCTGGAGAGGCAGCAAGG - Intergenic
934474591 2:94586042-94586064 AAAAATCTGCAGAGGGAAGAGGG + Intergenic
934604804 2:95686655-95686677 AAATATTTGCAGAGGGAGTATGG - Intergenic
936354569 2:111739117-111739139 AAATGTCTGGAGAGGCAGCAAGG + Intergenic
936538254 2:113329187-113329209 AAATATTTGCAGAGGGAGTGTGG - Intergenic
936726426 2:115323378-115323400 AAATAACTGCAGATGTGGTAGGG - Intronic
937534290 2:122866986-122867008 GAATATCTGCAGATGGGACATGG + Intergenic
938774230 2:134527211-134527233 ATAGATTTGCAGAGGGGTCAGGG - Intronic
939344894 2:140951223-140951245 AAATATATACAGAGGAGCCAAGG - Intronic
939603263 2:144220367-144220389 AAGTTTCTGCAGAGGAAGCACGG + Intronic
939623484 2:144448646-144448668 CAAAATCTGGAGAGGGGGCGTGG + Intronic
939716980 2:145596120-145596142 AAATATCAGCAGAAGTGGGAGGG - Intergenic
940112368 2:150169026-150169048 AAATATCTCCATATGGGGAAGGG - Intergenic
941350645 2:164429840-164429862 AAATAACTGCAGGGGGTGGACGG + Intergenic
941694573 2:168537272-168537294 AATTATCTGCAGAGGGAAAATGG - Intronic
941694728 2:168538772-168538794 AATTATCTGCAGAGGGAAAATGG - Intronic
942699474 2:178688205-178688227 AAGTATCTGCAGAGGAGGAATGG - Exonic
942741030 2:179178333-179178355 AAAGACTTGCAGAGGGGGCTAGG + Intronic
943840882 2:192579030-192579052 TAATAGCTGCAGAGGGGACTTGG + Intergenic
944884030 2:204044329-204044351 CAATATCTGCAGAGAGGCCAGGG - Intergenic
945700925 2:213170177-213170199 AAGTTTATGCAGAGGGGCCAGGG - Intergenic
946631841 2:221677836-221677858 GAAACTCTGCTGAGGGGGCAGGG - Intergenic
946634002 2:221704566-221704588 AAATCTATGGAGAGGGAGCAAGG - Intergenic
946723661 2:222639432-222639454 AAAAATCTGCAGAGGAAGAAAGG + Intronic
947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG + Intergenic
948017891 2:234704957-234704979 CAGCTTCTGCAGAGGGGGCAGGG + Intergenic
1168994890 20:2125728-2125750 AAACATTGGCAGAGGAGGCAAGG + Intronic
1170446444 20:16432654-16432676 AAATATCTGCAGAGGCCTGAGGG - Intronic
1171208832 20:23301600-23301622 GAACATCTGGAGAGGGAGCAGGG + Intergenic
1172574473 20:35997119-35997141 AAAGATCTGCAGAGGATGGAAGG - Intronic
1173728672 20:45313831-45313853 AAATGTCTGCCCTGGGGGCAGGG - Intronic
1174327738 20:49792618-49792640 AAATATCAGCAGGCAGGGCACGG - Intergenic
1175652260 20:60735746-60735768 AAATCTCTGCAGAGCTGGGAGGG + Intergenic
1176912216 21:14579775-14579797 AAATATCTGAAGAAGTGGCCAGG - Intronic
1177068692 21:16473329-16473351 AAATATCTGATGGGGGAGCACGG - Intergenic
1180038757 21:45265002-45265024 AAATGTCTGCAGAGCGACCAGGG - Exonic
1182341616 22:29626445-29626467 AAATATCTGCAGATGGGGCTGGG - Intronic
1182363398 22:29761290-29761312 AAATAGCTGTAGACAGGGCATGG + Intronic
1182577178 22:31280895-31280917 GAATAACTGCAGAGGAGGAAGGG - Intergenic
1183169947 22:36180409-36180431 GATTATCTGCACAGTGGGCAGGG + Intergenic
1184244016 22:43226860-43226882 GCATGCCTGCAGAGGGGGCAGGG + Intronic
1184342001 22:43891289-43891311 AGAAGTCTGCAGTGGGGGCAGGG + Exonic
1184703108 22:46190893-46190915 AAATATTTACAAAGGGGGCTGGG + Intronic
1184937548 22:47736055-47736077 AAATGACTGCAGTGGGGGCTGGG - Intergenic
1184942159 22:47776926-47776948 AAGTACCAGCAGAGTGGGCATGG - Intergenic
949618531 3:5783751-5783773 AAATATCTGCACCGGGGGCATGG - Intergenic
949618918 3:5788036-5788058 AAATAACTGCAGAGGGAGGGAGG - Intergenic
950025232 3:9815667-9815689 AGATAGCTGCTGAGGGGGCAGGG - Intronic
950170758 3:10837757-10837779 AAATTCCTGCAGAGGAGGCCTGG + Intronic
950353123 3:12376732-12376754 AAGTTTCAGCAGAAGGGGCAGGG - Intronic
952570449 3:34709617-34709639 AAATATTTGCAGAAAGGTCAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955079173 3:55641893-55641915 AAATGTCTTCAGAGGGCACAAGG + Intronic
955559638 3:60174792-60174814 AAATAACTGCTGAGTGGGCATGG - Intronic
955564319 3:60227363-60227385 AAATATTTTCAGAGGTGGGATGG - Intronic
956245212 3:67175227-67175249 AAGTATCTGGAGAAAGGGCATGG - Intergenic
958714611 3:97764579-97764601 AAATGTGTGCACAGGTGGCAGGG - Exonic
960573346 3:119206457-119206479 AACTAGCTGGAGAGGGGGCAGGG - Intergenic
962001786 3:131305573-131305595 AAACATCTGCAGTGGAGCCAGGG - Intronic
964224113 3:154377659-154377681 AAATAATTGCAGAGTGGGCCGGG - Intronic
964242775 3:154616143-154616165 GCATGTTTGCAGAGGGGGCAGGG - Intergenic
965299586 3:166993444-166993466 AAATATATGCAAATGGGGCCAGG + Intergenic
966495943 3:180580811-180580833 AAATAGCTGAAGAGGAGGGAAGG + Intergenic
966780605 3:183580953-183580975 AGATTTCTGCAAATGGGGCAGGG + Intergenic
967486349 3:190035869-190035891 TAATATTTGGAGTGGGGGCAGGG + Intronic
968238490 3:197053479-197053501 AAATATCTGCTGGCAGGGCATGG + Intronic
968289226 3:197525864-197525886 ACAGACCTGCAGAGGGAGCACGG - Intronic
968289233 3:197525906-197525928 AGAGACCTGCAGAGGGAGCACGG - Intronic
969365946 4:6694359-6694381 AAACCTGTGCAGTGGGGGCAGGG + Intronic
969893266 4:10279345-10279367 AAGTATGTGGAGAGGGAGCAAGG + Intergenic
970295904 4:14629895-14629917 AAATATCAGCACAGGGGGCCAGG + Intergenic
970438715 4:16061002-16061024 AAATATCTGCAAAGAGCTCAGGG - Intronic
972431402 4:38985982-38986004 AAGTAATTGCAGAGTGGGCATGG - Intronic
972509813 4:39758209-39758231 ATAGATCTGCAGACAGGGCATGG - Intronic
973783227 4:54310335-54310357 TGATATCTGCAGAGGGGTCCTGG + Intergenic
974081864 4:57222115-57222137 AAATAACTGCTGATGGGGCTAGG - Intergenic
976721232 4:88170636-88170658 CAATTTCTGGAGAGAGGGCAGGG - Intronic
976847495 4:89506694-89506716 CAATATCTGCAGTGGGGTCCAGG + Intergenic
978496225 4:109362060-109362082 AACTAACTGCAGAGGAGGCTGGG - Intergenic
979561484 4:122106863-122106885 AAATATCTGCAGAGGCCACAAGG - Intergenic
979587029 4:122432587-122432609 AAAGTGCTGCAGAGGGGTCAAGG + Intergenic
979683284 4:123484253-123484275 AAATATATCCAGATGGGGCCAGG - Intergenic
980334911 4:131459779-131459801 AAATTTCTGGAAAAGGGGCAGGG - Intergenic
980976359 4:139614455-139614477 AAATATCTCGAGATCGGGCATGG - Intergenic
982199385 4:152945324-152945346 AAAAATCTGCATAGGGTGCAGGG - Intronic
982918247 4:161241991-161242013 AAATCTCTGTGGAGGGGGGAAGG - Intergenic
983629374 4:169834166-169834188 AATTTTCAGCAGAGGAGGCAGGG - Intergenic
986709476 5:10478220-10478242 AAGTATCTGGAGAGGGCTCAAGG - Intergenic
987380070 5:17276495-17276517 AAATATCTGGAGAGGAAGAATGG - Exonic
988352141 5:30122631-30122653 ACATATATGCAGAGAGAGCAAGG - Intergenic
988438272 5:31202342-31202364 AAATATTTGCAGGCCGGGCATGG + Intronic
989982838 5:50664630-50664652 AAATATTCGGAGATGGGGCAAGG + Intergenic
993036061 5:82759006-82759028 AAATAACTGGAGTGGGGTCAGGG + Intergenic
995573394 5:113504605-113504627 AAATCTCTGGAGAGGGGGCCTGG + Intergenic
995586298 5:113652236-113652258 CAATTTCTGAAGAGAGGGCAGGG + Intergenic
996855415 5:128000355-128000377 AAAAATTTGCAGAGGAGGTAAGG - Intergenic
998300427 5:141013516-141013538 AAATCTCTGAAAAGGGGGTAAGG - Intergenic
1001017976 5:168158659-168158681 AAATGTCTCCAGACTGGGCACGG + Intronic
1001859331 5:175039592-175039614 GAATATCAGCAGAGGAGGTATGG + Intergenic
1004026023 6:11819281-11819303 AAAGATCTGCAGCCTGGGCATGG - Intergenic
1006798242 6:36744197-36744219 AAACATCTGGGGTGGGGGCAGGG + Intronic
1007684025 6:43654392-43654414 AAATATATGCATAGAGGGCTGGG + Intronic
1007729997 6:43939836-43939858 AAATTTCCTCAGAGGGGGCAGGG - Intergenic
1007762081 6:44139097-44139119 AAATATCTGAGGAGGGAGGAAGG - Intronic
1009862342 6:69350379-69350401 AAATATCTGCAGGAGTAGCAAGG - Intronic
1011204277 6:84874737-84874759 AAATATCCTTAGAGTGGGCATGG + Intergenic
1015768278 6:136742477-136742499 TAATTTCTGCAGAGGGTGTAAGG - Intronic
1016026972 6:139297421-139297443 AAATGTCTGGAAAGGGGGCAGGG + Intergenic
1017985294 6:159438292-159438314 AAATCACTGCAGAGGTGGCTGGG + Intergenic
1018122932 6:160655251-160655273 AGTTATCTGCAGAAGTGGCAGGG + Intronic
1018759310 6:166877160-166877182 AAATCTCTGCATGGGGGTCAGGG - Intronic
1021450657 7:20780712-20780734 AATTTTCTGCAGGGTGGGCAGGG - Intergenic
1023092183 7:36627692-36627714 GAACATCTGAAGAGGGGCCATGG - Intronic
1023112845 7:36831434-36831456 AAACATCTCTAGAAGGGGCATGG + Intergenic
1023172857 7:37406219-37406241 AAAAATCTGCAGTTGGTGCAAGG + Intronic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1024505304 7:50157480-50157502 AAATGGCTGCAGAGGTGGGAAGG - Intronic
1026462389 7:70626201-70626223 AAAGATCTTCAGAGCAGGCATGG - Intronic
1027725496 7:81800157-81800179 AAAAATATGCAGAGGGGGCTGGG - Intergenic
1028584633 7:92440467-92440489 AGATACCAGCTGAGGGGGCAGGG + Intergenic
1031223760 7:119007824-119007846 AAAAATCTGGATAGGGTGCAGGG + Intergenic
1032271967 7:130417293-130417315 AAAGATCGTCAGCGGGGGCAGGG - Intronic
1032450462 7:132026018-132026040 AATTTTCAGCAGAGGGGGCTGGG + Intergenic
1032645962 7:133824324-133824346 AAATGTGGGCAGAGAGGGCAGGG - Intronic
1033541243 7:142357983-142358005 AAGTGTCTGCAGAGGGAGCCGGG - Intergenic
1034954591 7:155326789-155326811 AAACATCTGGAGACGTGGCAGGG + Intergenic
1035727830 8:1835455-1835477 AAACAGCTGCAGGGGCGGCAGGG - Intronic
1036158903 8:6368272-6368294 AAATATCTTTAGACTGGGCATGG + Intergenic
1036590953 8:10167613-10167635 AAAGGACTGCAGAGGAGGCAGGG + Intronic
1036712773 8:11092525-11092547 AAAGCTCTGCAGTGGGGACAGGG + Intronic
1037617203 8:20530343-20530365 AAATATTTGCAGAGCCAGCAGGG - Intergenic
1038148501 8:24920402-24920424 AAACATCAGCAGAGGAGTCAGGG + Intergenic
1038222258 8:25621899-25621921 AATTATGTGCGGAGGGGGCTGGG + Intergenic
1039721495 8:40169296-40169318 AAATATCAGCAGTGGGGTCAGGG + Intergenic
1040553314 8:48456340-48456362 AAATAACTGAAGACTGGGCATGG + Intergenic
1040985306 8:53287370-53287392 TAATATCTGCAGAGGGCTCAGGG - Intergenic
1041327136 8:56679959-56679981 AAATATATACAGAAGGGGCCAGG - Intergenic
1042906057 8:73773421-73773443 AAATATCTGGGGAGTGGGGATGG - Intronic
1044776601 8:95695442-95695464 AAATATCTTCAGAGAAGGCTGGG + Intergenic
1046635541 8:116671328-116671350 CAATATCTGCATAGGGAGCTAGG + Intronic
1048067233 8:130983016-130983038 AAATATATGCAGAGTGGGAGTGG + Intronic
1048461537 8:134625504-134625526 AACCACCTGCAGAGGGAGCAGGG - Intronic
1050909079 9:11043635-11043657 ACATATCTGAAGAGGGTGGACGG - Intergenic
1053683477 9:40500059-40500081 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1053933457 9:43128374-43128396 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054280238 9:63124869-63124891 AAAAATCTGCAGAGGGAAGAGGG + Intergenic
1054296581 9:63335557-63335579 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054394598 9:64640062-64640084 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054429247 9:65145261-65145283 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054501137 9:65876274-65876296 AAAAATCTGCAGAGGGAAGAGGG + Intergenic
1055517437 9:77047377-77047399 AAAGAGCTGCAGTAGGGGCAGGG + Intergenic
1056390489 9:86136874-86136896 TAATAGGTGCAGAGAGGGCAGGG - Intergenic
1057279915 9:93701938-93701960 AATTGTCTGCAGAGGCGGCCTGG - Intergenic
1057873746 9:98737118-98737140 AAATGTGTGTATAGGGGGCAGGG - Intronic
1059306211 9:113355150-113355172 AAAAATCTGCAGTGGAGGCCAGG - Intronic
1059806178 9:117802938-117802960 AAATATCTTCATAGGCGACACGG + Intergenic
1060428212 9:123524505-123524527 AAATATTTGGAGACAGGGCATGG - Intronic
1060454032 9:123773121-123773143 AAATAAGAGCAGAGGGGGCAGGG + Intronic
1060958025 9:127658255-127658277 AAATATCTACAGTGGGGGACCGG - Intronic
1062359553 9:136181193-136181215 AAATTTGTGCAAAGGGGGCCGGG + Intergenic
1186022533 X:5272129-5272151 AAATATATGCAGTAGGGGCCAGG - Intergenic
1193575814 X:83194175-83194197 AACTGTCTGGAGAGTGGGCAGGG - Intergenic
1200374670 X:155767374-155767396 TATAATCTGCAGTGGGGGCAGGG - Intergenic