ID: 1100360179

View in Genome Browser
Species Human (GRCh38)
Location 12:93870572-93870594
Sequence CAGAGCTTCCACCCTACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100360179_1100360185 6 Left 1100360179 12:93870572-93870594 CCACCAGTAGGGTGGAAGCTCTG 0: 1
1: 0
2: 1
3: 10
4: 185
Right 1100360185 12:93870601-93870623 CTGCAGCAGCCAAGAGTACTGGG 0: 1
1: 0
2: 1
3: 19
4: 202
1100360179_1100360184 5 Left 1100360179 12:93870572-93870594 CCACCAGTAGGGTGGAAGCTCTG 0: 1
1: 0
2: 1
3: 10
4: 185
Right 1100360184 12:93870600-93870622 ACTGCAGCAGCCAAGAGTACTGG 0: 1
1: 0
2: 2
3: 15
4: 211
1100360179_1100360186 7 Left 1100360179 12:93870572-93870594 CCACCAGTAGGGTGGAAGCTCTG 0: 1
1: 0
2: 1
3: 10
4: 185
Right 1100360186 12:93870602-93870624 TGCAGCAGCCAAGAGTACTGGGG 0: 1
1: 0
2: 2
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100360179 Original CRISPR CAGAGCTTCCACCCTACTGG TGG (reversed) Intronic
900211072 1:1456137-1456159 CAGAGCCTCCACACTCCGGGTGG + Intronic
900223979 1:1524185-1524207 CAGAGCCTCCACACTCCGGGTGG + Intronic
902277501 1:15350238-15350260 CAGAGCTTCCATCCTAGCGCAGG + Intronic
904397168 1:30229691-30229713 CAGAGCTCCCATCCAACAGGAGG - Intergenic
905581327 1:39084450-39084472 CACAGCGTCCAGCCTGCTGGGGG - Intronic
906892293 1:49730396-49730418 AAGAGCTGCAACCCTTCTGGGGG + Intronic
909273313 1:73652194-73652216 CAGAGCTTACAACAGACTGGAGG - Intergenic
909839153 1:80295988-80296010 CAGTTCTTCCACCCTACATGAGG - Intergenic
910919508 1:92328935-92328957 CAGAGCTACCAGGCTTCTGGCGG + Intronic
911617915 1:100035551-100035573 CAGAGCTTACATTCTAGTGGGGG - Intergenic
912755024 1:112317093-112317115 CAGAGCTTCCACCCTAAGGAGGG - Intergenic
915036352 1:152928984-152929006 CAGAGCTTACATCCTGGTGGGGG - Intergenic
916899143 1:169201824-169201846 GAGAGTTACCAGCCTACTGGTGG + Intronic
918696271 1:187550454-187550476 CAGAGTTTCCTTCCTTCTGGCGG + Intergenic
919208271 1:194446458-194446480 CAGAGCTTCCACCCTATAAGTGG + Intergenic
923613468 1:235516417-235516439 CGGAGCTTCCATTCTAGTGGGGG + Intergenic
1064821086 10:19333758-19333780 CAAAGCTTACACACTGCTGGTGG - Intronic
1065353037 10:24812582-24812604 CAGAGCTTCCATCCTCATGTAGG + Intergenic
1065421223 10:25546713-25546735 CGGAGCCTGCAGCCTACTGGAGG + Intronic
1065815294 10:29477679-29477701 CTGTGCTTCCCCCCTGCTGGAGG + Intronic
1065957572 10:30706666-30706688 CTGTGCTTCCCCCCTGCTGGAGG - Intergenic
1067682884 10:48451366-48451388 CAGTGCTTCCTCCCTGCTTGCGG - Intronic
1068772240 10:60835143-60835165 CAGAGTTTACAACCTGCTGGAGG + Intergenic
1069800441 10:71078464-71078486 CTGAGCTTCCACACTATTAGGGG + Intergenic
1072675937 10:97466144-97466166 CAGTGCTGCCACCCTGCTGGAGG + Exonic
1073179695 10:101576138-101576160 CAGAGCTGCCATCCTTCTGGAGG + Intronic
1073440319 10:103548889-103548911 CAGAGCTCCCACCCTCCATGTGG + Intronic
1075316856 10:121459971-121459993 CAGAGATTCCACCCTTCAGAGGG + Intergenic
1079127807 11:17731222-17731244 CAGAGCCTCAGCCCTCCTGGTGG - Intergenic
1080425783 11:32153029-32153051 CAGAACTTCCCCCTTCCTGGCGG + Intergenic
1080685851 11:34514076-34514098 CAGAGATTCCACCCTGGTGCCGG + Intergenic
1080763510 11:35275180-35275202 AAGAGCCTCCACCCTCCAGGAGG - Intronic
1080891060 11:36409586-36409608 CAGCTCTTCCCCCCTACTGTGGG - Intronic
1084367628 11:68712938-68712960 GGGAGCTTCCACCCTGTTGGAGG + Intronic
1084762123 11:71280581-71280603 CAGAGCGTCCACACCACAGGAGG + Intergenic
1086408559 11:86520652-86520674 CTGAGCTTCAAGTCTACTGGAGG - Intronic
1089580855 11:119481342-119481364 CAGAGATTACATCCTAATGGGGG - Intergenic
1090719614 11:129459534-129459556 CAGGGCTTCCCTCCTTCTGGTGG + Intergenic
1091810274 12:3391225-3391247 CAGAGCTTGCAATCCACTGGAGG + Intronic
1100360179 12:93870572-93870594 CAGAGCTTCCACCCTACTGGTGG - Intronic
1100432442 12:94542643-94542665 CAGAGCTACAATCCTTCTGGAGG - Intergenic
1101118670 12:101556355-101556377 CCTAGCTTCCTCCCTGCTGGGGG - Intergenic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1102588703 12:113941402-113941424 CTGTGCTTCCACCCTACAGAAGG - Intronic
1104757192 12:131276677-131276699 CACAGCTTCCGCCCTACGGTGGG - Intergenic
1104917323 12:132272392-132272414 CAGCGCCACCACCCTACTGCCGG + Intronic
1104944571 12:132409869-132409891 CAGAGCTGCCACCGTCCTGTGGG + Intergenic
1104946207 12:132415885-132415907 CACGGCTCCCACCCCACTGGAGG + Intergenic
1106229687 13:27812252-27812274 CACAGCTACCACCCTAGTGCAGG - Intergenic
1107831892 13:44381897-44381919 CTGAGCTTATATCCTACTGGAGG - Intronic
1108705060 13:52977824-52977846 CAGTGCTTCCAGCATCCTGGAGG - Intergenic
1112493096 13:99884605-99884627 CAGGGCTTCCAGTCTAATGGCGG - Intronic
1112552283 13:100432748-100432770 CACTGCTTGCACCCTAGTGGAGG - Intronic
1112785161 13:102943455-102943477 AAAAGCTTCCTCTCTACTGGGGG + Intergenic
1114301934 14:21386044-21386066 CAGTGCTTCCACCCTGCATGAGG + Exonic
1121940663 14:98067558-98067580 CAGAGCTTACAGTCTACTTGCGG + Intergenic
1122217969 14:100216434-100216456 TACAGTTTGCACCCTACTGGAGG - Intergenic
1127324618 15:57883217-57883239 CAGAACTCCCACACTTCTGGTGG - Intergenic
1128480219 15:68031051-68031073 CAGAGCTTCATTCCTTCTGGAGG - Intergenic
1128599161 15:68980966-68980988 AAGAGATGGCACCCTACTGGTGG + Intronic
1129683245 15:77670464-77670486 CAGAGCTTCCACTCTTGTGAGGG - Intronic
1133467494 16:6041932-6041954 CAGAGCTTCTTACCTTCTGGAGG + Intronic
1133850621 16:9500066-9500088 CAGAGCATCCAGCCTAGGGGAGG - Intergenic
1134243340 16:12521960-12521982 GAGAGCTGCCACCCCTCTGGAGG + Intronic
1136097181 16:27965554-27965576 CAGAGCTTGCAGCTTGCTGGGGG - Intronic
1136261004 16:29075783-29075805 CAGAGCTTACAGCATATTGGGGG + Intergenic
1138559419 16:57791726-57791748 CAGAGCCACCACCCAACTCGAGG + Intronic
1141825704 16:86478337-86478359 CAGAGCTTCCTCCATCTTGGTGG - Intergenic
1144129815 17:12235356-12235378 CTGAGCCTCCTCCCTCCTGGGGG + Intergenic
1146209299 17:30929606-30929628 CAGGGTTTCCACCCTCATGGTGG + Intronic
1146895644 17:36539754-36539776 CAGAGCTTGCAATCTAGTGGAGG + Intronic
1151703561 17:75755504-75755526 CAGGGCCTGCACCCTGCTGGAGG + Intronic
1151845083 17:76648059-76648081 CACAGTTTCCACCCTACAAGTGG + Intergenic
1154062179 18:11072158-11072180 CAAAGATTCTACCCTACTGAAGG - Intronic
1154293704 18:13132019-13132041 CAGAGCTCCCCCTCCACTGGGGG - Intergenic
1155348449 18:24882256-24882278 AAGAGCTTACACTCTAGTGGTGG - Intergenic
1155540991 18:26868047-26868069 CAGAGCTTCCCACCTCCTGGTGG - Intergenic
1157091660 18:44643881-44643903 CAGAGCTTACAGTCTACTGTTGG + Intergenic
1157121722 18:44917626-44917648 CAGAGCTCCAACCCTCCTGCTGG - Intronic
1157603755 18:48912666-48912688 CAGAGCTCACACTCTACTAGGGG + Intergenic
1157617890 18:48998229-48998251 CACAGCTTCCTCCCTCCTGCTGG + Intergenic
1158012810 18:52748421-52748443 AAGAGCTGCAACCCTTCTGGAGG - Intronic
1158926604 18:62270465-62270487 CAGTATTTCCACCTTACTGGTGG - Intronic
1159017285 18:63111483-63111505 CAGAGCTGCCTCCCTTCTGGAGG - Intergenic
1160763995 19:798975-798997 CAGAGCTTCCACCCGGGTAGGGG - Intronic
1162155806 19:8677388-8677410 CAGAGCTCAGACCCTGCTGGGGG + Intergenic
1165331175 19:35141759-35141781 CCGAGCTCCCAGCCTAGTGGAGG + Intronic
1165834476 19:38745749-38745771 CAGACCTTCCACCCTCGTTGAGG + Intronic
1166024269 19:40066300-40066322 TAGAGCTTCCAACCTATGGGTGG + Intergenic
1166343906 19:42153711-42153733 CAGAGCCTCCAGCCCACTTGTGG - Intronic
924965348 2:71556-71578 CAGAGCTTCCACCCAATCTGAGG + Intergenic
925419620 2:3701940-3701962 CAGAGCATCCATCCTGCAGGTGG - Intronic
926686884 2:15704878-15704900 CAGGGCTGCCACCCTACTCCTGG + Intronic
927194910 2:20540435-20540457 CAGAGCTTCCCCCAGGCTGGAGG + Intergenic
928285072 2:29982955-29982977 CAGAGCTCCATCCCTCCTGGAGG - Intergenic
929379939 2:41337606-41337628 CAGAGCTTCATTCCTCCTGGAGG - Intergenic
935718501 2:105959745-105959767 GAGAGCTGCCAGCCTCCTGGAGG + Intergenic
935878328 2:107536180-107536202 CCGAGCCTCCACCCTGCTGTGGG - Intergenic
936466270 2:112753968-112753990 TAGAGCTTACACTCTAGTGGAGG - Intronic
939427198 2:142054652-142054674 AGGAGCTTCCACTCTACTGAAGG - Intronic
940215246 2:151296981-151297003 CAAAGCTTCCACGCTACGGAAGG - Intergenic
944237353 2:197452579-197452601 CAGAGCTTATATCCTAGTGGGGG - Intergenic
945154228 2:206821298-206821320 CAGATCTTGCATTCTACTGGAGG + Intergenic
945704920 2:213218176-213218198 TAGAGCTTCTGCCCTACAGGTGG - Intergenic
947025533 2:225733769-225733791 CAGAGCTGCCACTCCACGGGAGG + Intergenic
948599563 2:239100620-239100642 CAGAGCTTCCACCCAGCCGTTGG - Intronic
1169116706 20:3071246-3071268 CAGAGCCTCCTCCCACCTGGAGG + Intergenic
1173484577 20:43431015-43431037 CAGAGCTTCCAGGCTAAGGGTGG + Intergenic
1175264464 20:57694168-57694190 AAGTGCTTCCATCCTACAGGAGG + Intronic
1178976660 21:37226550-37226572 CACACCCTCCACCCTTCTGGGGG - Intronic
1179168906 21:38957720-38957742 TGGAGCTTCCACTCTACAGGTGG + Intergenic
1181918278 22:26298435-26298457 CAGTGCCTCCACCTTACAGGTGG - Intronic
1182546350 22:31078948-31078970 CAGAGCTTCCCCCATCCTAGTGG + Intronic
1183154434 22:36064213-36064235 TAGAGCTTACATGCTACTGGAGG - Intergenic
1183404552 22:37623989-37624011 CAGACCTTCCTCCCTAATGAGGG + Intronic
1183806897 22:40219435-40219457 AAGAACTTCCACCCTCCTGCTGG - Intronic
1183924999 22:41199490-41199512 CAGAGCTTCCTACCTCCTGCAGG + Intergenic
1183977051 22:41518305-41518327 CAGAGCTCACACCCTAGTGCAGG - Intronic
951890503 3:27563809-27563831 TAGAGCTTACATTCTACTGGTGG - Intergenic
952358073 3:32603140-32603162 CAGAGCTCACACCCCACAGGAGG + Intergenic
956017745 3:64901789-64901811 CTGAGGTTCCAGCCTCCTGGGGG + Intergenic
956200364 3:66699240-66699262 AAGATCTTCCAGTCTACTGGAGG + Intergenic
959672136 3:108990657-108990679 CAGAGCTTCCATTCTAGTTGGGG - Intronic
960587919 3:119337483-119337505 CAAAGCTTCCACAATACTGACGG + Intronic
961179446 3:124865088-124865110 CAAAGCTTCCATCCTTCTGAAGG + Intronic
961361502 3:126370918-126370940 CAGAGCATGCACCTTCCTGGGGG + Intergenic
961522382 3:127474421-127474443 CAGACCTTGCACCCTCCAGGTGG + Intergenic
963353056 3:144176146-144176168 AAGAGCTGCAACCCTTCTGGGGG - Intergenic
963440553 3:145334145-145334167 CAAAGCTTCCACCCTGCGGAAGG - Intergenic
964505096 3:157390807-157390829 AAGAGCTGCGACCCTTCTGGAGG + Intronic
969256068 4:6002643-6002665 CAGAGCTTCCCCCCACCAGGTGG + Intergenic
969718186 4:8878437-8878459 CAGAGCATCCATCCTCCAGGCGG - Intergenic
970709255 4:18842856-18842878 AAGAGCTGCCACTCTTCTGGGGG - Intergenic
972507789 4:39736885-39736907 TAGAGCTTTCACCATTCTGGTGG + Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
982065490 4:151650974-151650996 CAGAGCATACATTCTACTGGGGG - Intronic
982131604 4:152233807-152233829 TAGAGCTGCCAGCCTGCTGGGGG - Intergenic
984291546 4:177801450-177801472 CAAAGCTTACACACTATTGGCGG - Intronic
986236183 5:5912964-5912986 CATAGCTTCCACTCTAGTGACGG + Intergenic
986268274 5:6209365-6209387 TAGTGCTTACACCCTGCTGGTGG + Intergenic
986460620 5:7967246-7967268 CAGGGCTTCCCTCCTTCTGGAGG - Intergenic
988681556 5:33488964-33488986 AAGAGCTACAACCCTTCTGGGGG - Intergenic
989204385 5:38796972-38796994 CAAAGATTCCACCCTACTTCTGG + Intergenic
989952840 5:50321023-50321045 CAGAGCGTCCCCTCTGCTGGTGG + Intergenic
995038471 5:107561972-107561994 CACAGCCTCCTCCCCACTGGGGG + Intronic
997637870 5:135427906-135427928 AACAGTTTCCACCCAACTGGTGG + Intergenic
999735368 5:154509087-154509109 CAGAGCATTTAGCCTACTGGGGG + Intergenic
1001849554 5:174951761-174951783 AAGAGCTTACATCCTAATGGGGG + Intergenic
1003019595 6:2497977-2497999 CAGAGCTTCCCATCCACTGGAGG - Intergenic
1003586209 6:7391280-7391302 CAGAGCTTGCACCCTAGCAGGGG + Intronic
1007781429 6:44257063-44257085 CAGAGCTTCCTCCCTCCCCGGGG + Intronic
1011629274 6:89308909-89308931 CAGGGCTTCCAACCTAGTCGGGG + Intronic
1011890918 6:92158798-92158820 AAGAGCTTACACTCTACTTGGGG + Intergenic
1012132829 6:95518873-95518895 AAGAGCTGCGGCCCTACTGGAGG - Intergenic
1015686040 6:135862042-135862064 CAGAGCATCCAGAATACTGGTGG + Intronic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1018098678 6:160416919-160416941 CAGAGTGTCCACACTTCTGGTGG + Intronic
1020232527 7:6330780-6330802 CAGAGCTTCAACACCACTGCAGG + Exonic
1022218812 7:28291769-28291791 CAAAGCTTTCACCCCAGTGGGGG + Intergenic
1022546553 7:31194403-31194425 CAGAGATTCCATCCTACAGCTGG + Intergenic
1023470107 7:40508309-40508331 TAGAGCTTCCACCCTATGTGTGG + Intronic
1024794496 7:53005005-53005027 CAGAGCTTCCACACTGCAGAAGG - Intergenic
1024868001 7:53925908-53925930 CGGAGCTTGCACTCTAGTGGGGG - Intergenic
1033421603 7:141209037-141209059 CAAGGCTTGCACCCTGCTGGAGG - Intronic
1034493102 7:151404850-151404872 CAGAGCTTCGGACCTGCTGGTGG + Intronic
1034863301 7:154618642-154618664 CCCAGCTTCCACCCTCCTGATGG + Intronic
1036755918 8:11471090-11471112 CAGAGCGTCCACCTTAGTGCTGG + Intronic
1037550084 8:19962253-19962275 CTGAGCTTGCACCCTAAGGGAGG + Intronic
1037997279 8:23362161-23362183 CAGAGTTTCCTCCCTTCTGAAGG - Intronic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1045912611 8:107427679-107427701 CAGAGCTTCAAACCTAGAGGAGG - Intronic
1046873497 8:119228833-119228855 CTGAGCTTCTACCTTCCTGGAGG - Intronic
1048613419 8:136048715-136048737 CAGAGCTTTCACTCCACTGGTGG - Intergenic
1048646432 8:136426462-136426484 CTGAGCTACCACTGTACTGGTGG + Intergenic
1049411397 8:142475467-142475489 CACAGCTTCCAGCCGCCTGGGGG - Exonic
1050950810 9:11590271-11590293 AAACGCTTCCACACTACTGGTGG + Intergenic
1052801700 9:32974108-32974130 CAAAGCTCCCACCCAACTGATGG + Intronic
1053493269 9:38527434-38527456 CAGAGCTTCAACACCACTGCAGG - Intergenic
1054931925 9:70644164-70644186 CAGAGCTTACATCCTACTGGTGG + Intronic
1056899940 9:90588826-90588848 CAGAGCTGCCCTCCTTCTGGAGG + Intergenic
1057202736 9:93151423-93151445 CAGAACTGCCACCCTAGTTGGGG - Intergenic
1057345728 9:94248806-94248828 TAGAGCTTCCACCCTAGGAGTGG - Intergenic
1057673958 9:97122012-97122034 CAGAGCTTCAACACCACTGCAGG - Intergenic
1060964275 9:127703859-127703881 AAGAGCTTCCACGCTCCAGGTGG + Intronic
1062301953 9:135878604-135878626 CAAAGCTTTCACTCTACAGGTGG - Intronic
1186148243 X:6646897-6646919 CAGAGCTTCTCCCCTTTTGGTGG - Intergenic
1186990460 X:15061617-15061639 CTGTGCTTCCAGCCTACGGGTGG - Intergenic
1188982457 X:36739215-36739237 GAGAGCATCCAGCCTAGTGGAGG - Intergenic
1189186623 X:39060586-39060608 AAGAGCTACAACCCTTCTGGGGG - Intergenic
1193616893 X:83699891-83699913 CCTACCCTCCACCCTACTGGAGG + Intergenic
1194268749 X:91783512-91783534 GAGAGCTTCCAGACTGCTGGTGG + Intronic
1194549148 X:95274358-95274380 CATAGGGGCCACCCTACTGGAGG - Intergenic
1194901524 X:99517943-99517965 CAGAGCTTTCAGAATACTGGGGG - Intergenic
1195423745 X:104704386-104704408 CAGAGCCTCCACAGTACTTGGGG + Intronic
1195668867 X:107452655-107452677 CAGAGCCTCTACCCCACTGGAGG + Intergenic
1197181488 X:123541629-123541651 CAGAGCTTCCATTCTAGTGGAGG + Intergenic
1200585951 Y:5004435-5004457 GAGAGCTTCCAGACTGCTGGTGG + Intronic