ID: 1100368933

View in Genome Browser
Species Human (GRCh38)
Location 12:93947343-93947365
Sequence CTGATAAGAAGGAGATTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 246}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100368933_1100368940 11 Left 1100368933 12:93947343-93947365 CCTACTAATCTCCTTCTTATCAG 0: 1
1: 0
2: 2
3: 28
4: 246
Right 1100368940 12:93947377-93947399 TGAACCTTCGGAGGGCGAAGGGG 0: 1
1: 3
2: 34
3: 135
4: 520
1100368933_1100368937 3 Left 1100368933 12:93947343-93947365 CCTACTAATCTCCTTCTTATCAG 0: 1
1: 0
2: 2
3: 28
4: 246
Right 1100368937 12:93947369-93947391 ACTTTCAGTGAACCTTCGGAGGG 0: 1
1: 0
2: 40
3: 112
4: 365
1100368933_1100368936 2 Left 1100368933 12:93947343-93947365 CCTACTAATCTCCTTCTTATCAG 0: 1
1: 0
2: 2
3: 28
4: 246
Right 1100368936 12:93947368-93947390 CACTTTCAGTGAACCTTCGGAGG 0: 1
1: 0
2: 8
3: 67
4: 174
1100368933_1100368939 10 Left 1100368933 12:93947343-93947365 CCTACTAATCTCCTTCTTATCAG 0: 1
1: 0
2: 2
3: 28
4: 246
Right 1100368939 12:93947376-93947398 GTGAACCTTCGGAGGGCGAAGGG 0: 1
1: 3
2: 33
3: 134
4: 269
1100368933_1100368938 9 Left 1100368933 12:93947343-93947365 CCTACTAATCTCCTTCTTATCAG 0: 1
1: 0
2: 2
3: 28
4: 246
Right 1100368938 12:93947375-93947397 AGTGAACCTTCGGAGGGCGAAGG 0: 1
1: 2
2: 41
3: 141
4: 269
1100368933_1100368935 -1 Left 1100368933 12:93947343-93947365 CCTACTAATCTCCTTCTTATCAG 0: 1
1: 0
2: 2
3: 28
4: 246
Right 1100368935 12:93947365-93947387 GTTCACTTTCAGTGAACCTTCGG 0: 1
1: 1
2: 4
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100368933 Original CRISPR CTGATAAGAAGGAGATTAGT AGG (reversed) Intergenic
905603383 1:39273383-39273405 ATGATAAGAAAGAGGTTGGTTGG + Intronic
908746387 1:67380841-67380863 CTTATAAGAAGGAGACAATTTGG - Intronic
909017896 1:70399412-70399434 CTGACAAGAGGCAGATTAATGGG + Intergenic
909946838 1:81673329-81673351 CTGAAAAGAAGGAATTTTGTTGG - Intronic
910466860 1:87509403-87509425 TTCATCAGAAGGAGCTTAGTAGG + Intergenic
911118599 1:94272294-94272316 CTTAGAAAAAGGAGGTTAGTGGG - Intronic
911879073 1:103210258-103210280 AAGACAAGAAGTAGATTAGTGGG - Intergenic
912185406 1:107269149-107269171 CTAACAAGGAGGAGATTCGTAGG - Intronic
913199753 1:116486006-116486028 CTGATAAGAGGGAGATTGTGAGG + Intergenic
913281454 1:117189140-117189162 CTGATAAGAAGGGTAGAAGTTGG - Intronic
914807573 1:151002711-151002733 CCAATAAGAAGGAAATCAGTGGG + Intronic
915758829 1:158290508-158290530 TAGATAAGATGGAGCTTAGTGGG + Intronic
916371931 1:164108001-164108023 CTGACAAGAAGGAGAGAAGTAGG - Intergenic
916643638 1:166759792-166759814 CAGATTAGAGGGAGATTAGAGGG + Intergenic
917117246 1:171614995-171615017 CTGAGAAAAAGGTGAGTAGTAGG + Intergenic
917698967 1:177560815-177560837 GTGATAAGAGAGAGATTAATTGG + Intergenic
917971697 1:180212059-180212081 CAGATGAGAGGGAGTTTAGTCGG - Intergenic
918092213 1:181307369-181307391 CTGATAGGAAGGAGGTAAGCTGG + Intergenic
918746822 1:188212502-188212524 CTGAAAAGAAGTTGATTAATGGG - Intergenic
919443091 1:197663854-197663876 CAGATAAGAAAGTGAGTAGTCGG - Intronic
920884420 1:209912751-209912773 CTTAGAAGAAGGAGATTAGTGGG - Intergenic
921123787 1:212159241-212159263 CTGATAACAAGGTGACCAGTAGG + Intergenic
923402045 1:233625012-233625034 CTGATAAAAGGCAGATTAATAGG + Intronic
923526387 1:234776015-234776037 CTGATAAGAATCAGATTTCTAGG - Intergenic
1064059463 10:12125626-12125648 ATGAAAAGAAGTAGATTAATGGG + Intergenic
1065263997 10:23956507-23956529 CTGATTAGAAGGGGGTTAGAAGG - Intronic
1066190976 10:33055993-33056015 CTGACAAAAAGCAAATTAGTAGG + Intergenic
1067522657 10:47019841-47019863 CTGAGAAGATGGAGCTTGGTGGG + Intergenic
1069862099 10:71478062-71478084 CTGAAAGCAAGGAGACTAGTTGG - Intronic
1070216641 10:74389379-74389401 ATGATAGGAAATAGATTAGTTGG + Intronic
1071810863 10:89179471-89179493 CTGTTAAGAAAGAGATTTATGGG + Intergenic
1072900120 10:99399806-99399828 CTGACAAGAGGCAGATTAATAGG - Intronic
1073296357 10:102441564-102441586 CTGTTACGAAGGACATTACTGGG - Intergenic
1073831780 10:107392858-107392880 CTAATAAAAAGGAGATGAGGTGG - Intergenic
1074283897 10:112079895-112079917 CAGAGAAGAAGGAGATTAACAGG - Intergenic
1076082737 10:127598332-127598354 CTGAAAAGAAGGAAAGTTGTAGG + Intergenic
1082194919 11:49292309-49292331 CTGATAAAAAGGATATTGGAGGG + Intergenic
1087668450 11:101077746-101077768 CTGATGAGAAGGACATCAGTTGG + Intronic
1088287631 11:108204504-108204526 CTGAGAAGAATGAGATTACATGG - Intronic
1088524481 11:110738163-110738185 TTTATAAGAGGAAGATTAGTAGG + Intergenic
1090018459 11:123106284-123106306 CTGACAAGAGGCAGATTAATAGG - Intronic
1091026205 11:132143337-132143359 CTGATAAAAAAGAGATTCCTGGG - Intronic
1091194569 11:133720089-133720111 CTGGTAAGGAGGAGATTTGGAGG + Intergenic
1092500369 12:9040114-9040136 CTGAAAAGTAGGAGAGAAGTAGG + Intergenic
1092840151 12:12532600-12532622 CTGAGAAGAAGGAGTACAGTAGG - Intronic
1092904854 12:13091883-13091905 CTGATAAGAGGCAGATTAATAGG - Intronic
1092958317 12:13570922-13570944 CTGATATGAATGAGAACAGTGGG + Intronic
1095710581 12:45283985-45284007 CTGACAAGAGGCAGATTAATAGG + Intronic
1097052842 12:56233821-56233843 CTGTTGAGAGGGAGATTAGATGG + Intronic
1097156941 12:57018874-57018896 CTGACATGAAGCAGATTAATAGG - Intronic
1098381064 12:69870027-69870049 CTGAGAGGAAGGAGTTTAGAAGG + Intronic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1100368933 12:93947343-93947365 CTGATAAGAAGGAGATTAGTAGG - Intergenic
1101518298 12:105458133-105458155 CTGAAATGAAGAAGATTAGAAGG - Intergenic
1101953952 12:109197501-109197523 CTGGTACGGAGGAGCTTAGTAGG - Intronic
1103240881 12:119412424-119412446 CTGATAAGAAGGATGTGTGTTGG - Intronic
1104524286 12:129503869-129503891 GTGATAAGAAGAAGATGAGGAGG - Intronic
1106653160 13:31714156-31714178 CTAAGAATAAGGAGTTTAGTAGG + Intergenic
1106744982 13:32692579-32692601 TTGGTAACAAGGAGATTTGTGGG + Intronic
1107724594 13:43285933-43285955 CTGATGAGAAGGAAATTGGCTGG + Intronic
1108061374 13:46536778-46536800 CTGATAAGAGGCAGATTAATAGG + Intergenic
1108421758 13:50257681-50257703 ATGATAAGAAGGAGGTTTGCAGG - Intronic
1108467050 13:50726894-50726916 CTGATAAGAAAAAGATTAACTGG - Intronic
1109491775 13:63110582-63110604 CTGATAGAAAGCAGATGAGTTGG - Intergenic
1109863545 13:68231756-68231778 CAGATAAGAAGGAGATTACCAGG - Intergenic
1110623692 13:77627375-77627397 CTGAAAAGAAGTCGATTAATGGG + Intronic
1112191798 13:97185536-97185558 CTGATAAGAGGGAGATAAGAGGG + Intergenic
1112342013 13:98560453-98560475 CAGATGAGAAGGAGATTTGCAGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114571567 14:23672802-23672824 CTGATTTTAAGGAGATGAGTGGG - Intergenic
1117712698 14:58548881-58548903 CTGATAAGAAGGCGTTTCGTTGG - Intronic
1119322967 14:73742411-73742433 CTGCTCAGAAGGAGATGAGGCGG + Intronic
1120506826 14:85363116-85363138 CTGCTAATAAGGGGACTAGTGGG + Intergenic
1122449142 14:101789961-101789983 CTGATAAGGAAGAGATTAAAAGG - Intronic
1122727073 14:103763342-103763364 CTGATAAGGAAGAGATTAAAAGG - Intronic
1122757048 14:103989937-103989959 CTGATAATAAGGAGATCTGATGG - Intronic
1124638665 15:31381445-31381467 CTTATAAGAGGGAGATTAGGAGG - Intronic
1125848692 15:42883780-42883802 CTGAAAAGACAGAGATTAGCAGG + Intronic
1126178791 15:45764894-45764916 CTTAGAAGAGGGAGTTTAGTAGG + Intergenic
1127055276 15:55125202-55125224 CTAACAACAAGGAGATTGGTTGG + Intergenic
1129534039 15:76296333-76296355 CTTATCAGATGTAGATTAGTGGG - Intronic
1129743651 15:78002955-78002977 CTAATAAGCAGGGGATTAGGGGG - Intronic
1129745154 15:78013870-78013892 CTTAAAACAAGGAGATTATTTGG + Intronic
1129938326 15:79470351-79470373 GTGATAAAGAGGAGAATAGTGGG - Exonic
1130078034 15:80707089-80707111 TTGATAAAAAGCAGATTAATAGG + Intronic
1130175277 15:81562542-81562564 CTGTTATGAAGAAGATTAGTTGG + Intergenic
1134424663 16:14128920-14128942 CTGATAACAAGGAGATTTTTGGG - Intronic
1135768012 16:25194711-25194733 CTGACAAGAGGCAGATGAGTAGG + Intergenic
1137381326 16:48002314-48002336 CTGATAAGAAGCAGGTTAATAGG + Intergenic
1139334855 16:66224554-66224576 CTGAAAAGTAGGACATTTGTGGG - Intergenic
1140848196 16:78909670-78909692 CTGGTAAGAAATATATTAGTGGG - Intronic
1141409427 16:83822338-83822360 CTTATAAGAAGAAGTTTACTTGG - Intergenic
1143309240 17:5974928-5974950 CAGAGAAGAAGGAGTTGAGTTGG + Intronic
1150661753 17:67086881-67086903 CTGATAAGGAGTAGATGAGGTGG + Exonic
1151021544 17:70623062-70623084 CTGATAAGAAGGAAATGGGTAGG - Intergenic
1153146781 18:2042224-2042246 TTGCTAAGAAGAAGATTAGAAGG + Intergenic
1153505066 18:5788584-5788606 CTCATAAAAGGCAGATTAGTTGG + Intergenic
1154291859 18:13115552-13115574 CTGATAAGAAGGAGGTGAGGAGG + Intronic
1156905905 18:42351773-42351795 CTGACAAGAGGCAGATTAATAGG + Intergenic
1157630759 18:49093008-49093030 CTGAGAAGAAGGAGAGAAATAGG + Intronic
1159193904 18:65086186-65086208 CTGATAATAAGGTGTTTTGTAGG + Intergenic
1159514497 18:69440119-69440141 CTGAGAAGAGGGAGAGAAGTGGG + Intronic
1161625783 19:5325733-5325755 CTGAGGAGAAGGAGATGAATTGG - Intronic
1161897211 19:7091408-7091430 CTGACAAGAGGAAGATCAGTGGG - Intergenic
1166034384 19:40156874-40156896 CGGATAAAAAGAAGATTAGACGG + Intergenic
1166265170 19:41677243-41677265 CTTAGAAGCAGGAGTTTAGTGGG + Intronic
1166404766 19:42512222-42512244 CCGAGAAGCAGGAGTTTAGTGGG + Intronic
1166414391 19:42583089-42583111 CTGAGAAGCAGGAGTTTATTGGG + Intronic
1166424931 19:42669211-42669233 CTGAGAAGCAGGAGTTTATTGGG - Intronic
1166437510 19:42781041-42781063 CTGAGAAGCAGGAGTTTAGTGGG + Intronic
1166466412 19:43035704-43035726 CTGAGAAGCAGGAGTTTAGTGGG + Intronic
1166486206 19:43215124-43215146 CTGAGAAGCAGGAGTTTAGTGGG + Intronic
1166493323 19:43278764-43278786 CTGAGAAGCAGGAGTTTAGTGGG + Intergenic
1168026041 19:53644297-53644319 CTGATAGGAAGCAGATTAGCAGG - Intergenic
928588520 2:32788645-32788667 CAGATATGAAGGAGATTACTGGG - Intronic
928875608 2:36035074-36035096 CTGAAAAGAATGAGATCAGGAGG - Intergenic
928891223 2:36205232-36205254 CTTATACGAAGGAGATTCATTGG - Intergenic
929375666 2:41283765-41283787 CTGAGAAGAAGCATATTAATAGG - Intergenic
930695527 2:54407746-54407768 CTGATAAAAGGCAGATTAATAGG - Intergenic
931436975 2:62256145-62256167 CTGACAAAAAGCAGATTAATAGG + Intergenic
931448640 2:62348710-62348732 CTGATATGAGGCAGATTAATAGG - Intergenic
931765788 2:65455151-65455173 CTGTTATAAAGGACATTAGTGGG + Intergenic
933389101 2:81648712-81648734 CTGACAATAAGCAGATTAATAGG + Intergenic
934030661 2:88043025-88043047 CCCGTAAGAAGGAGAGTAGTAGG - Intronic
936791335 2:116157052-116157074 TTGATAAAAGGCAGATTAGTAGG + Intergenic
938056940 2:128222875-128222897 CTGATATGAGGCAGATTAATAGG + Intergenic
939709824 2:145503597-145503619 CTGTTAAGAAGGAAATTGCTTGG - Intergenic
942397601 2:175568214-175568236 AGGATAAGAAGGAGATAACTGGG + Intergenic
942399299 2:175584451-175584473 CTGACAAGAAGTAAAGTAGTGGG - Intergenic
943143338 2:184010650-184010672 CAGATAAAAAGAAGTTTAGTAGG - Intergenic
944865041 2:203851644-203851666 CTCAGAAGAGGGAGATTAATGGG - Intergenic
944899413 2:204198945-204198967 CTGACAAGAGGCAGATTAATAGG - Intergenic
945487236 2:210411032-210411054 CTGATAAGAAGGAGAGAGATGGG + Intergenic
945549247 2:211198732-211198754 ATCAGAAGAAGGAGATCAGTGGG - Intergenic
946976091 2:225153241-225153263 CTTATAAGAAGGAAATTAATAGG - Intergenic
947427857 2:230000054-230000076 CTGATAAGAAGCTGATTATTAGG + Intronic
948957053 2:241301320-241301342 CTGATAAGTAGACGATTAGGTGG - Intronic
1169879544 20:10331546-10331568 CAAAGAAGAAGGAGATTAGGAGG + Intergenic
1171208597 20:23300122-23300144 CTAATAAAAAGGGGAATAGTGGG + Intergenic
1172439345 20:34954785-34954807 CAGAGAAGAAGCAGATTTGTGGG - Intronic
1172856488 20:38007694-38007716 TTGATGAAAAGGAGATTAGCAGG - Intronic
1173381604 20:42549457-42549479 CAGAGAAGAAGGAGATAAGAGGG + Intronic
1174516736 20:51098352-51098374 CTCAATTGAAGGAGATTAGTGGG - Intergenic
1175018004 20:55812540-55812562 CAAATAAAAGGGAGATTAGTAGG + Intergenic
1175491624 20:59384180-59384202 GTGATAGGGAGGAGATGAGTGGG + Intergenic
1179160288 21:38890474-38890496 CTGACAAAAGGCAGATTAGTAGG - Intergenic
1179592269 21:42416632-42416654 CTCATAAGAAGCAGATGAATGGG + Intronic
1182261577 22:29076013-29076035 CTCATAAGAAGGAAAGTAGAAGG + Intronic
1184120500 22:42446654-42446676 CTTATAAGAAGGAGAGGAGACGG + Intergenic
1184805954 22:46794921-46794943 CTGAGAAGATGGAGATTGTTAGG + Intronic
949895002 3:8762161-8762183 CGGATCAGGAGGAGATTAGCAGG - Intronic
951468496 3:23029567-23029589 CTGCTCAGAAGGAGATAAGCAGG - Intergenic
952217269 3:31290015-31290037 CTGAAAAGAGGAAGATTAATAGG + Intergenic
953671587 3:44967250-44967272 CTGAAATGAAGGACATTGGTAGG - Intronic
954932841 3:54298830-54298852 CTGCTACTCAGGAGATTAGTTGG + Intronic
955753245 3:62203603-62203625 CCGAAAAGAAGGAGAAGAGTGGG + Exonic
956181350 3:66520644-66520666 CTGATGAGAAAGAGATGACTAGG - Intergenic
957189468 3:76988270-76988292 CTGATTAGAAAGAGGTCAGTAGG + Intronic
957451762 3:80389291-80389313 CTGATGAGAAGGAGAAAAATTGG - Intergenic
958501102 3:94910142-94910164 CTGAGAAGAAGCAGATTAATAGG - Intergenic
958719888 3:97831021-97831043 CTGACAAGAGGCAGATTAATAGG + Intronic
961018844 3:123487237-123487259 CAGATAAGAAAGAGAGAAGTGGG + Intergenic
961953428 3:130774079-130774101 CTGTTATTAAGGAGATAAGTAGG - Intergenic
963822029 3:149908043-149908065 CTGACAAGAAGAAAATGAGTTGG + Intronic
964656454 3:159072347-159072369 TTGATAAAAAGGAGAGTAATAGG + Intronic
964873767 3:161342477-161342499 CTGACAAAAGGGAGATTAATAGG + Intergenic
966296892 3:178434318-178434340 ATGAGAAGAGGAAGATTAGTTGG + Intronic
969738345 4:9006075-9006097 CGGACAGGAAGGAGATGAGTTGG + Intergenic
971562139 4:28092632-28092654 CTAATAAGAAAGTGATAAGTTGG + Intergenic
971739399 4:30501381-30501403 CTTATAAGAAGTTGATTAGGAGG - Intergenic
972571333 4:40312904-40312926 CTGATAATAAGTAGATAAGGAGG + Intergenic
974031316 4:56779265-56779287 CTGATTAGAAGGATATAGGTAGG - Intergenic
974104647 4:57456039-57456061 CTGATAACAAGGATAATATTAGG + Intergenic
974173109 4:58292610-58292632 CTGATGAGAAGGAGAAAAATTGG + Intergenic
974883066 4:67783382-67783404 CTGAAAAGAGGGAGATAAGAAGG - Intergenic
975572858 4:75835869-75835891 CTGACAAGAGGCAGATTAATAGG + Intergenic
976005060 4:80419914-80419936 CTGACAACAGGCAGATTAGTTGG + Intronic
976121533 4:81788707-81788729 GTGATAAGAAGTAGATTACATGG + Intronic
977348755 4:95852941-95852963 CTGACATGAAGCAGATTAATAGG + Intergenic
978931113 4:114313095-114313117 CTGACATGAAGCAGATTAATAGG - Intergenic
981039396 4:140209567-140209589 CTGATAAGAAGCAGATGGTTAGG + Intergenic
981258558 4:142692172-142692194 CTGATAAAAGGCAGATTAATTGG + Intronic
983766985 4:171496423-171496445 AGGAAAAGAAGGAGATAAGTGGG + Intergenic
986417680 5:7545123-7545145 GTCATAAGAAGGAGGTTACTGGG + Intronic
986685387 5:10271621-10271643 CTGACAAGAGGCAGATTAATAGG - Intergenic
986861036 5:11926998-11927020 CTGACATGAGGTAGATTAGTAGG - Intergenic
986884202 5:12214013-12214035 CAGAGAAAAAGGATATTAGTGGG + Intergenic
988205614 5:28129802-28129824 CTGACAAAAGGGAGATTAATAGG + Intergenic
989138136 5:38175528-38175550 CCTATAAGAAGGACATCAGTCGG - Intergenic
989558320 5:42822545-42822567 CTGATAAGATGCATATTAATAGG - Intronic
989602203 5:43210738-43210760 CTGACATGAAGCAGATTAATAGG + Intronic
989614834 5:43329227-43329249 CTGATGAGAAGGAGAAAAGCTGG + Intergenic
990115564 5:52386019-52386041 CTGGAAAGAAGGAGAATAGCAGG + Intergenic
991065430 5:62419695-62419717 ATGATAAGAAGTATAGTAGTGGG + Intronic
991635455 5:68699891-68699913 GTTATAAGAGGAAGATTAGTAGG - Intergenic
992477221 5:77115501-77115523 CTGATAAGAAGGAAGTTTGAGGG + Intergenic
993457033 5:88139435-88139457 GTGATAAGCAGGAGTTTAGTAGG - Intergenic
993833038 5:92782992-92783014 CTGACAAAAAGCAGATTAATAGG - Intergenic
994027703 5:95104004-95104026 CTGATATGATGGAGAGTTGTGGG - Intronic
994862627 5:105217810-105217832 AAGATAACAAGGAGATTAATTGG + Intergenic
996775030 5:127123332-127123354 CTTAGAAGAAGGAGGTTAATGGG - Intergenic
996882265 5:128312929-128312951 CTGAAAAGCAGGAGATTGCTTGG - Intronic
998415691 5:141944756-141944778 CAGCTGAGAAGCAGATTAGTTGG + Exonic
1000200917 5:159010208-159010230 CAGATGAGATGGAGATGAGTAGG + Intronic
1001179330 5:169504177-169504199 CTGATAAGAAAGAGGAAAGTGGG + Intergenic
1003789533 6:9528004-9528026 CTGATGAGGAGGTGATTTGTAGG + Intergenic
1005279193 6:24253042-24253064 GTGATAAGAGGGAAATTCGTGGG + Intronic
1006751702 6:36382105-36382127 ATGAGAAGCAGGAGATTAGATGG - Intronic
1008634572 6:53396821-53396843 CTGATAAGGCTGAGACTAGTTGG + Intergenic
1009515606 6:64612908-64612930 CTGAGAAGAAAGATATTAGAGGG + Intronic
1009749944 6:67869947-67869969 CTGATGAGAAGGAGAGAAATTGG + Intergenic
1012607818 6:101180046-101180068 CTCAAAAGAAGGAAAATAGTAGG - Intergenic
1012902477 6:105022293-105022315 CTGACAAGAGGCAGATTAATAGG + Intronic
1013919160 6:115380280-115380302 CTGAAGAGAGGGAGAGTAGTGGG - Intergenic
1014441719 6:121480941-121480963 CTGCTAAGAAGCAGATTTGGGGG - Intergenic
1014540697 6:122672197-122672219 CTGAGAAGGAGGAGAAGAGTAGG + Intronic
1014970525 6:127809465-127809487 CTGAAAATAAGGAGGTTAGTAGG + Intronic
1014989043 6:128051301-128051323 CTGATAAAAAGGAGATTGCTAGG - Intronic
1015236647 6:130978877-130978899 AGGATAAGAAGGAGCTTACTGGG + Intronic
1018328437 6:162700226-162700248 CTGACAATAAGCAGATTAATGGG - Intronic
1019231662 6:170570509-170570531 CTGAGAAAAATGAGATTACTAGG + Intronic
1019862155 7:3669098-3669120 CTGAGAAGAAGTAGAATATTAGG + Intronic
1020749604 7:12123810-12123832 TTGACAAGAGGGAGATTAATAGG - Intergenic
1021485870 7:21167976-21167998 CTGATAAGTAGGAGTTTACCTGG - Intergenic
1024714633 7:52062098-52062120 CTGACAAAAGGCAGATTAGTAGG - Intergenic
1029872555 7:103710315-103710337 CTGCTAAGAAGAAGCTGAGTTGG + Intronic
1030748842 7:113204268-113204290 ATGTTAAAAAGGAGAATAGTAGG + Intergenic
1031172759 7:118312571-118312593 CTGACAAGAGGCAGATTAATAGG + Intergenic
1031748787 7:125542378-125542400 GTGGTAAGAAGGAGATGACTGGG - Intergenic
1033172441 7:139095956-139095978 CTGAGAAAAAGGAGAGTAGATGG + Intronic
1033627828 7:143128238-143128260 CTGACAAAAAGTAGATTAATAGG - Intergenic
1038302464 8:26366180-26366202 CTGAGAAGATTGAGATTAATAGG + Intronic
1038495732 8:28000816-28000838 CTTGTAAGAAGGAATTTAGTGGG + Intergenic
1041130283 8:54691735-54691757 CTGATAAAATGCAGATTAATAGG + Intergenic
1041651498 8:60307568-60307590 CTGATGAGAAGGAGAAAAATTGG + Intergenic
1042400305 8:68337516-68337538 CTGTTATGAAAGAGATTATTGGG + Intronic
1042602824 8:70515264-70515286 CTGATTACAAAGTGATTAGTAGG - Intergenic
1042682855 8:71405815-71405837 GTGATAAGAAGGAAAGTAATAGG - Intronic
1044100312 8:88127968-88127990 CTCATAACAAGGAGATGGGTTGG + Intronic
1044107214 8:88224341-88224363 CAGATAAGCAGGACATTAATAGG + Intronic
1046182243 8:110666174-110666196 CTAAAAAGAAGGAGAGAAGTGGG - Intergenic
1047098038 8:121645027-121645049 CTGACATGAAGTAGATTAATAGG + Intergenic
1047344508 8:124014066-124014088 CTGACAAAAAGTAGATTAATAGG + Intronic
1047689945 8:127341582-127341604 CAGATGAGAAGGAGCTTGGTAGG - Intergenic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1051188574 9:14486600-14486622 CTGATGAGAAGGAATTTGGTTGG + Intergenic
1051794342 9:20848073-20848095 CTGACAAAAAGGAGATTAATAGG + Intronic
1052356822 9:27513563-27513585 GGGATACAAAGGAGATTAGTTGG - Intronic
1052466268 9:28833805-28833827 CTGATAAGAAGGATATTGGTAGG + Intergenic
1052761765 9:32599684-32599706 GTGCTAAGGAGGAGATTAATGGG + Intergenic
1053349715 9:37405191-37405213 CTGACAAAAGGCAGATTAGTAGG + Intergenic
1054756300 9:68961733-68961755 CTGAAAATAAGGAGATAAGGAGG - Intronic
1056493870 9:87136430-87136452 CTGATAAGAGGGAGGTTGGGGGG + Intergenic
1056638877 9:88353250-88353272 CTGACAAGATGCAGATTAATAGG - Intergenic
1057217637 9:93238270-93238292 CTGAAATCAAGGAGATTATTGGG + Exonic
1058170760 9:101678374-101678396 CTGATGAGAAGGAGTTTAATAGG + Intronic
1058594303 9:106599045-106599067 CTGAGGAGACAGAGATTAGTCGG - Intergenic
1060494585 9:124108885-124108907 CTGACAAGCTGGAGATTAGAGGG - Intergenic
1061755752 9:132811326-132811348 CTTATAAGAAGGAGGTAAGAGGG + Intronic
1186017736 X:5217187-5217209 GTGATGAGAAGGATATAAGTAGG + Intergenic
1186154464 X:6711104-6711126 CTGACAAGAGGCAGATTAATAGG + Intergenic
1187841358 X:23492343-23492365 CTGATAAAAGGCAGATTAATAGG + Intergenic
1188254539 X:27944816-27944838 TAGATAAAAAGGAGATTATTGGG - Intergenic
1189001833 X:36956368-36956390 CTGACAAAAAGCAGATTAATAGG - Intergenic
1192284638 X:69721771-69721793 GTGATAACAAGAAGATGAGTTGG - Intronic
1193473687 X:81937561-81937583 CTGAAAAGAAACAGAGTAGTAGG - Intergenic
1193814900 X:86093007-86093029 GTTATAAGAAGGAGATTTGCTGG + Intergenic
1194758373 X:97764386-97764408 GTGACAAAAAGGAGATTTGTTGG + Intergenic
1195256757 X:103098216-103098238 CTCACAAGAGGGAGATTAATAGG - Intergenic
1195776359 X:108410310-108410332 CTGAGTAGAAGTAGTTTAGTGGG + Intronic
1196424548 X:115556636-115556658 CTGAAAAGAATGAGAATAATAGG - Intergenic
1197351515 X:125388597-125388619 CTGACAAGAGGCAGATTAGTAGG + Intergenic
1197662496 X:129189202-129189224 CTGACAAAAAGCAGATTAATAGG + Intergenic
1198746126 X:139892432-139892454 CTGGTAAAAAGGCAATTAGTGGG + Intronic
1201548578 Y:15194471-15194493 CTGACAAGAGGCAGATTAATAGG + Intergenic
1201862696 Y:18616691-18616713 CTGAAAAGAAGGAGACTAAAAGG + Intergenic
1201870627 Y:18703689-18703711 CTGAAAAGAAGGAGACTAAAAGG - Intergenic