ID: 1100371560

View in Genome Browser
Species Human (GRCh38)
Location 12:93973442-93973464
Sequence GTTTAAGGGCCTCCAAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100371556_1100371560 26 Left 1100371556 12:93973393-93973415 CCCTGAAAAGAAAACTGAACTTT No data
Right 1100371560 12:93973442-93973464 GTTTAAGGGCCTCCAAAATTTGG No data
1100371557_1100371560 25 Left 1100371557 12:93973394-93973416 CCTGAAAAGAAAACTGAACTTTG No data
Right 1100371560 12:93973442-93973464 GTTTAAGGGCCTCCAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100371560 Original CRISPR GTTTAAGGGCCTCCAAAATT TGG Intergenic
No off target data available for this crispr