ID: 1100377134

View in Genome Browser
Species Human (GRCh38)
Location 12:94027888-94027910
Sequence CCTGTTTGACACCTGGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100377125_1100377134 7 Left 1100377125 12:94027858-94027880 CCCCAGCTGAGCTTTCAGATGAG No data
Right 1100377134 12:94027888-94027910 CCTGTTTGACACCTGGATTGTGG No data
1100377127_1100377134 5 Left 1100377127 12:94027860-94027882 CCAGCTGAGCTTTCAGATGAGCC No data
Right 1100377134 12:94027888-94027910 CCTGTTTGACACCTGGATTGTGG No data
1100377126_1100377134 6 Left 1100377126 12:94027859-94027881 CCCAGCTGAGCTTTCAGATGAGC No data
Right 1100377134 12:94027888-94027910 CCTGTTTGACACCTGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100377134 Original CRISPR CCTGTTTGACACCTGGATTG TGG Intergenic
No off target data available for this crispr