ID: 1100378852

View in Genome Browser
Species Human (GRCh38)
Location 12:94043228-94043250
Sequence CTTTATTAGCAGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100378852_1100378857 18 Left 1100378852 12:94043228-94043250 CCATTCTCATTCTGCTAATAAAG No data
Right 1100378857 12:94043269-94043291 AATTTATAAAGGGAAAAAAGAGG No data
1100378852_1100378853 -7 Left 1100378852 12:94043228-94043250 CCATTCTCATTCTGCTAATAAAG No data
Right 1100378853 12:94043244-94043266 AATAAAGACATATGCAAGACTGG No data
1100378852_1100378856 8 Left 1100378852 12:94043228-94043250 CCATTCTCATTCTGCTAATAAAG No data
Right 1100378856 12:94043259-94043281 AAGACTGGGTAATTTATAAAGGG 0: 39
1: 155
2: 197
3: 244
4: 450
1100378852_1100378854 -6 Left 1100378852 12:94043228-94043250 CCATTCTCATTCTGCTAATAAAG No data
Right 1100378854 12:94043245-94043267 ATAAAGACATATGCAAGACTGGG 0: 22
1: 278
2: 2973
3: 4860
4: 8482
1100378852_1100378855 7 Left 1100378852 12:94043228-94043250 CCATTCTCATTCTGCTAATAAAG No data
Right 1100378855 12:94043258-94043280 CAAGACTGGGTAATTTATAAAGG 0: 1394
1: 2501
2: 4118
3: 3674
4: 2254
1100378852_1100378858 26 Left 1100378852 12:94043228-94043250 CCATTCTCATTCTGCTAATAAAG No data
Right 1100378858 12:94043277-94043299 AAGGGAAAAAAGAGGTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100378852 Original CRISPR CTTTATTAGCAGAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr