ID: 1100379817

View in Genome Browser
Species Human (GRCh38)
Location 12:94051146-94051168
Sequence GATTCCGGAGGGTTTTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100379817_1100379822 -5 Left 1100379817 12:94051146-94051168 CCTATTCAAAACCCTCCGGAATC No data
Right 1100379822 12:94051164-94051186 GAATCCCCCTTCTCATTTGGAGG No data
1100379817_1100379828 30 Left 1100379817 12:94051146-94051168 CCTATTCAAAACCCTCCGGAATC No data
Right 1100379828 12:94051199-94051221 TGCAAAGCCTATATGCACTTGGG No data
1100379817_1100379821 -8 Left 1100379817 12:94051146-94051168 CCTATTCAAAACCCTCCGGAATC No data
Right 1100379821 12:94051161-94051183 CCGGAATCCCCCTTCTCATTTGG No data
1100379817_1100379827 29 Left 1100379817 12:94051146-94051168 CCTATTCAAAACCCTCCGGAATC No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100379817 Original CRISPR GATTCCGGAGGGTTTTGAAT AGG (reversed) Intergenic
No off target data available for this crispr