ID: 1100379821

View in Genome Browser
Species Human (GRCh38)
Location 12:94051161-94051183
Sequence CCGGAATCCCCCTTCTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100379817_1100379821 -8 Left 1100379817 12:94051146-94051168 CCTATTCAAAACCCTCCGGAATC No data
Right 1100379821 12:94051161-94051183 CCGGAATCCCCCTTCTCATTTGG No data
1100379816_1100379821 -7 Left 1100379816 12:94051145-94051167 CCCTATTCAAAACCCTCCGGAAT No data
Right 1100379821 12:94051161-94051183 CCGGAATCCCCCTTCTCATTTGG No data
1100379815_1100379821 -6 Left 1100379815 12:94051144-94051166 CCCCTATTCAAAACCCTCCGGAA No data
Right 1100379821 12:94051161-94051183 CCGGAATCCCCCTTCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100379821 Original CRISPR CCGGAATCCCCCTTCTCATT TGG Intergenic
No off target data available for this crispr