ID: 1100379827

View in Genome Browser
Species Human (GRCh38)
Location 12:94051198-94051220
Sequence TTGCAAAGCCTATATGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100379817_1100379827 29 Left 1100379817 12:94051146-94051168 CCTATTCAAAACCCTCCGGAATC No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data
1100379816_1100379827 30 Left 1100379816 12:94051145-94051167 CCCTATTCAAAACCCTCCGGAAT No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data
1100379820_1100379827 14 Left 1100379820 12:94051161-94051183 CCGGAATCCCCCTTCTCATTTGG No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data
1100379825_1100379827 5 Left 1100379825 12:94051170-94051192 CCCTTCTCATTTGGAGGAAAATC No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data
1100379823_1100379827 7 Left 1100379823 12:94051168-94051190 CCCCCTTCTCATTTGGAGGAAAA No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data
1100379826_1100379827 4 Left 1100379826 12:94051171-94051193 CCTTCTCATTTGGAGGAAAATCT No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data
1100379818_1100379827 18 Left 1100379818 12:94051157-94051179 CCCTCCGGAATCCCCCTTCTCAT No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data
1100379824_1100379827 6 Left 1100379824 12:94051169-94051191 CCCCTTCTCATTTGGAGGAAAAT No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data
1100379819_1100379827 17 Left 1100379819 12:94051158-94051180 CCTCCGGAATCCCCCTTCTCATT No data
Right 1100379827 12:94051198-94051220 TTGCAAAGCCTATATGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100379827 Original CRISPR TTGCAAAGCCTATATGCACT TGG Intergenic
No off target data available for this crispr