ID: 1100380160

View in Genome Browser
Species Human (GRCh38)
Location 12:94054395-94054417
Sequence CACTGGACACCAAGGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100380156_1100380160 27 Left 1100380156 12:94054345-94054367 CCTGGGTGACAGAGAGAGACTCT 0: 747
1: 19854
2: 81296
3: 153632
4: 166246
Right 1100380160 12:94054395-94054417 CACTGGACACCAAGGCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100380160 Original CRISPR CACTGGACACCAAGGCTCAG TGG Intergenic
No off target data available for this crispr