ID: 1100383894

View in Genome Browser
Species Human (GRCh38)
Location 12:94087776-94087798
Sequence AGAGCCTGCTTCCCAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100383894_1100383898 29 Left 1100383894 12:94087776-94087798 CCTTTCTTTGGGAAGCAGGCTCT No data
Right 1100383898 12:94087828-94087850 GCTATTTGTTAGCAAAGACTTGG No data
1100383894_1100383896 -6 Left 1100383894 12:94087776-94087798 CCTTTCTTTGGGAAGCAGGCTCT No data
Right 1100383896 12:94087793-94087815 GGCTCTGCTAGCCAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100383894 Original CRISPR AGAGCCTGCTTCCCAAAGAA AGG (reversed) Intergenic