ID: 1100387418

View in Genome Browser
Species Human (GRCh38)
Location 12:94116630-94116652
Sequence TACCCAACACCATTTATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100387416_1100387418 8 Left 1100387416 12:94116599-94116621 CCTTGAAATTATTACATCAGTTG No data
Right 1100387418 12:94116630-94116652 TACCCAACACCATTTATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100387418 Original CRISPR TACCCAACACCATTTATTTA AGG Intergenic
No off target data available for this crispr