ID: 1100389381

View in Genome Browser
Species Human (GRCh38)
Location 12:94134603-94134625
Sequence ACGGAAAATTTTCTCTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100389381_1100389385 9 Left 1100389381 12:94134603-94134625 CCATCTTAGAGAAAATTTTCCGT No data
Right 1100389385 12:94134635-94134657 AGTTTCTACCAGGAAAAAGAGGG No data
1100389381_1100389384 8 Left 1100389381 12:94134603-94134625 CCATCTTAGAGAAAATTTTCCGT No data
Right 1100389384 12:94134634-94134656 AAGTTTCTACCAGGAAAAAGAGG No data
1100389381_1100389383 -1 Left 1100389381 12:94134603-94134625 CCATCTTAGAGAAAATTTTCCGT No data
Right 1100389383 12:94134625-94134647 TGTAAACAGAAGTTTCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100389381 Original CRISPR ACGGAAAATTTTCTCTAAGA TGG (reversed) Intergenic
No off target data available for this crispr