ID: 1100389382

View in Genome Browser
Species Human (GRCh38)
Location 12:94134622-94134644
Sequence GGTAGAAACTTCTGTTTACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100389382_1100389385 -10 Left 1100389382 12:94134622-94134644 CCGTGTAAACAGAAGTTTCTACC No data
Right 1100389385 12:94134635-94134657 AGTTTCTACCAGGAAAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100389382 Original CRISPR GGTAGAAACTTCTGTTTACA CGG (reversed) Intergenic
No off target data available for this crispr