ID: 1100390386 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:94141748-94141770 |
| Sequence | GCAATCAGTCTTGGGTGAGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1100390380_1100390386 | -6 | Left | 1100390380 | 12:94141731-94141753 | CCTCTTCCCTTCTTTTAGCAATC | No data | ||
| Right | 1100390386 | 12:94141748-94141770 | GCAATCAGTCTTGGGTGAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1100390386 | Original CRISPR | GCAATCAGTCTTGGGTGAGG TGG | Intergenic | ||