ID: 1100390386

View in Genome Browser
Species Human (GRCh38)
Location 12:94141748-94141770
Sequence GCAATCAGTCTTGGGTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100390380_1100390386 -6 Left 1100390380 12:94141731-94141753 CCTCTTCCCTTCTTTTAGCAATC No data
Right 1100390386 12:94141748-94141770 GCAATCAGTCTTGGGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100390386 Original CRISPR GCAATCAGTCTTGGGTGAGG TGG Intergenic