ID: 1100391634

View in Genome Browser
Species Human (GRCh38)
Location 12:94149612-94149634
Sequence GCCTGGCCACGCAGGAGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100391623_1100391634 18 Left 1100391623 12:94149571-94149593 CCACGACACGGCCATCGCGCTCA 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1100391634 12:94149612-94149634 GCCTGGCCACGCAGGAGCTGGGG 0: 1
1: 0
2: 1
3: 49
4: 406
1100391626_1100391634 7 Left 1100391626 12:94149582-94149604 CCATCGCGCTCAAGGACACGGAG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1100391634 12:94149612-94149634 GCCTGGCCACGCAGGAGCTGGGG 0: 1
1: 0
2: 1
3: 49
4: 406
1100391622_1100391634 22 Left 1100391622 12:94149567-94149589 CCGACCACGACACGGCCATCGCG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1100391634 12:94149612-94149634 GCCTGGCCACGCAGGAGCTGGGG 0: 1
1: 0
2: 1
3: 49
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100391634 Original CRISPR GCCTGGCCACGCAGGAGCTG GGG Exonic