ID: 1100391914

View in Genome Browser
Species Human (GRCh38)
Location 12:94150851-94150873
Sequence GCTTGCCTGGTTCAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100391914_1100391920 4 Left 1100391914 12:94150851-94150873 CCCTGGGGCTGAACCAGGCAAGC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 1100391920 12:94150878-94150900 CAGGTTTCCCCTGGGCTCCCAGG 0: 1
1: 0
2: 5
3: 34
4: 351
1100391914_1100391921 5 Left 1100391914 12:94150851-94150873 CCCTGGGGCTGAACCAGGCAAGC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 1100391921 12:94150879-94150901 AGGTTTCCCCTGGGCTCCCAGGG 0: 1
1: 0
2: 0
3: 17
4: 249
1100391914_1100391918 -5 Left 1100391914 12:94150851-94150873 CCCTGGGGCTGAACCAGGCAAGC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1100391914_1100391919 -4 Left 1100391914 12:94150851-94150873 CCCTGGGGCTGAACCAGGCAAGC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 1100391919 12:94150870-94150892 AAGCGATACAGGTTTCCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100391914 Original CRISPR GCTTGCCTGGTTCAGCCCCA GGG (reversed) Intronic