ID: 1100391918

View in Genome Browser
Species Human (GRCh38)
Location 12:94150869-94150891
Sequence CAAGCGATACAGGTTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100391913_1100391918 -2 Left 1100391913 12:94150848-94150870 CCACCCTGGGGCTGAACCAGGCA 0: 1
1: 0
2: 0
3: 33
4: 293
Right 1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1100391914_1100391918 -5 Left 1100391914 12:94150851-94150873 CCCTGGGGCTGAACCAGGCAAGC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1100391915_1100391918 -6 Left 1100391915 12:94150852-94150874 CCTGGGGCTGAACCAGGCAAGCG 0: 1
1: 0
2: 0
3: 8
4: 177
Right 1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100391918 Original CRISPR CAAGCGATACAGGTTTCCCC TGG Intronic
903132915 1:21290763-21290785 CAATCAAGACAGGTTCCCCCCGG + Intronic
906513687 1:46425600-46425622 CAAGCTATACAGGTCTGTCCTGG + Intergenic
913106468 1:115618156-115618178 ACAGTGATCCAGGTTTCCCCTGG + Intergenic
919856166 1:201707628-201707650 CAGGGGAAACAGGCTTCCCCAGG - Intronic
920665296 1:207959108-207959130 CAAGAGATGCTGGCTTCCCCCGG - Intergenic
923349515 1:233089925-233089947 CAAGAGAGACAGGTTTGGCCTGG + Intronic
1072965931 10:99972624-99972646 AAAGCGAGACCTGTTTCCCCCGG - Intronic
1073371462 10:102993640-102993662 AAAGCCATACAGGATTCCACAGG - Intronic
1075965090 10:126604264-126604286 CAGGTGATGCTGGTTTCCCCTGG - Intronic
1078941531 11:16011791-16011813 CAGTCCATACAGGTTTCCTCTGG - Intronic
1080515447 11:33015774-33015796 CCAGCGATCCAAGTTTCCTCGGG - Intergenic
1081259960 11:40947597-40947619 CAAGCCATACTAGTTTCCTCAGG + Intronic
1081711564 11:45219800-45219822 CAAGCTATCCAGGCCTCCCCTGG - Intronic
1097839135 12:64304158-64304180 CAAGTGATACTGGTTTTCCCTGG - Intronic
1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG + Intronic
1104493910 12:129218982-129219004 CTGGGGTTACAGGTTTCCCCGGG + Intronic
1111692258 13:91579194-91579216 AGAGCCATACAGGTTTCCCTCGG + Intronic
1120497503 14:85255153-85255175 CAATCAAGACTGGTTTCCCCTGG + Intergenic
1141711476 16:85701828-85701850 CAGGCGATACAGCTTCCACCTGG + Intronic
1146479441 17:33193214-33193236 GAAGTGATACAACTTTCCCCAGG + Intronic
1147190191 17:38733925-38733947 CAAGAGATACAGATGTCCCAGGG + Exonic
1152859776 17:82689398-82689420 CAAGCCAGCCAGGTTTCTCCAGG - Intronic
1157153828 18:45245227-45245249 CAAGGGCTACAGGAATCCCCAGG - Intronic
1164305974 19:24004023-24004045 CAAGCGGTCCAGGGTTCGCCTGG - Intergenic
1164996137 19:32720972-32720994 CAAGCGACACTGGCGTCCCCAGG + Intronic
926546226 2:14243734-14243756 AAAGGGATACAGTTTTCCACAGG - Intergenic
930774115 2:55155900-55155922 CAAGCTAGAAAGGTCTCCCCAGG + Intergenic
934912614 2:98273214-98273236 CAAGTGATACTGGTTTAGCCTGG + Intronic
936629767 2:114189521-114189543 CAAATGATACAGGTGTCCCCTGG - Intergenic
944926526 2:204470954-204470976 CAAGAGATAAATGTTTCCCTGGG + Intergenic
1171384213 20:24756773-24756795 CAAGGGAGACGGTTTTCCCCTGG + Intergenic
1172572285 20:35980136-35980158 CAGGCAATACAGGCTTCCCTGGG - Intronic
1174774850 20:53334275-53334297 CAAGGGATACAGTGTTTCCCAGG + Intronic
950270975 3:11614601-11614623 CCAGCCATCCAGGTTTCCCACGG + Intronic
953107667 3:39900974-39900996 CAAGCGTAACAGGTTTCCTGAGG + Intronic
955098954 3:55828326-55828348 CCAGAAAGACAGGTTTCCCCAGG - Intronic
955826930 3:62957324-62957346 CATTGGATATAGGTTTCCCCAGG + Intergenic
959677763 3:109055733-109055755 CCAGAAATACAGGTTCCCCCTGG + Intronic
961818870 3:129565138-129565160 CAAGCCAGCCAGGCTTCCCCGGG + Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
970809283 4:20072547-20072569 TAAGCCATAAAGGTTTCCCAAGG - Intergenic
977071680 4:92397921-92397943 CAAGTGATTCTAGTTTCCCCAGG - Intronic
979588480 4:122449307-122449329 CAAGTGATACAGCTATCCCATGG + Intergenic
983119516 4:163863799-163863821 CTAGCGCTACAAGTTTCTCCAGG - Intronic
985150271 4:186939965-186939987 CAAAAGATTCAGGTTTCCCAAGG - Intergenic
986365320 5:7023052-7023074 GAAGGGAGACAGTTTTCCCCTGG + Intergenic
1010807940 6:80260944-80260966 CAAGCAAAACATGTCTCCCCAGG - Intronic
1013558009 6:111276871-111276893 CAAGTCAAACAGGTTTCCTCTGG - Intergenic
1013558024 6:111276960-111276982 CAAGTCAAACAGGTTTCCTCCGG - Intergenic
1016785626 6:148007781-148007803 CAAGGTATACATTTTTCCCCTGG + Intergenic
1028504024 7:91551977-91551999 CAAGAGAAACAGGTTTCTACAGG - Intergenic
1030101793 7:105953190-105953212 GAAGGGAGACAGTTTTCCCCTGG - Intronic
1033280590 7:140003655-140003677 CAAGCCATACAGTTTTCTTCGGG + Intronic
1033967111 7:146989373-146989395 CACTGGATACAGGTTGCCCCAGG + Intronic
1034527593 7:151675572-151675594 CAAGCAGCACACGTTTCCCCTGG - Exonic
1035018741 7:155788145-155788167 CAATGTATTCAGGTTTCCCCAGG + Intergenic
1038891241 8:31726815-31726837 CATGGGATACAGGATGCCCCAGG + Intronic
1044388315 8:91617526-91617548 AAAGAGATACAGCTTTCACCTGG - Intergenic
1045331242 8:101157496-101157518 CAAGGGATACATGATACCCCAGG - Intergenic
1046268922 8:111867258-111867280 CAAGCAATAGAGATTTGCCCAGG - Intergenic
1046860032 8:119080238-119080260 CTAGCGATACAGGATTACCTTGG - Intronic
1047273458 8:123385139-123385161 ACAGCTATACAGGTTTCCACTGG + Intronic
1047283255 8:123464250-123464272 CAATGGATGCAGGTTGCCCCTGG + Intronic
1048872773 8:138812757-138812779 CAAGCCATGCAGGTTCCTCCAGG - Intronic
1050102855 9:2136613-2136635 CAAACAATACTGCTTTCCCCAGG - Intronic
1051999975 9:23266554-23266576 CAAGAGCTCCAGATTTCCCCAGG + Intergenic
1061639488 9:131940874-131940896 TAAGAGATACAGGTTTCATCTGG - Intronic
1196699546 X:118653290-118653312 GAAAAGATACAGCTTTCCCCTGG + Intronic
1199729645 X:150619106-150619128 CACGAGATACGCGTTTCCCCTGG + Exonic