ID: 1100391918

View in Genome Browser
Species Human (GRCh38)
Location 12:94150869-94150891
Sequence CAAGCGATACAGGTTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100391914_1100391918 -5 Left 1100391914 12:94150851-94150873 CCCTGGGGCTGAACCAGGCAAGC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1100391913_1100391918 -2 Left 1100391913 12:94150848-94150870 CCACCCTGGGGCTGAACCAGGCA 0: 1
1: 0
2: 0
3: 33
4: 293
Right 1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1100391915_1100391918 -6 Left 1100391915 12:94150852-94150874 CCTGGGGCTGAACCAGGCAAGCG 0: 1
1: 0
2: 0
3: 8
4: 177
Right 1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100391918 Original CRISPR CAAGCGATACAGGTTTCCCC TGG Intronic