ID: 1100396328

View in Genome Browser
Species Human (GRCh38)
Location 12:94189215-94189237
Sequence GAGAGTGGCCAGGGAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 1, 2: 7, 3: 63, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100396321_1100396328 17 Left 1100396321 12:94189175-94189197 CCAGTTTGGGGGCTTTGCCGGAA 0: 1
1: 0
2: 1
3: 3
4: 89
Right 1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG 0: 1
1: 1
2: 7
3: 63
4: 527
1100396323_1100396328 0 Left 1100396323 12:94189192-94189214 CCGGAAAATACATCAAGAAAGGA 0: 1
1: 0
2: 0
3: 56
4: 519
Right 1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG 0: 1
1: 1
2: 7
3: 63
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100396328 Original CRISPR GAGAGTGGCCAGGGAGCTGA GGG Intronic
901175996 1:7299623-7299645 GAATGTGGCCAGGGAGGAGATGG - Intronic
901234634 1:7661351-7661373 GAGAGTGGACAGGAGGCTGAGGG - Intronic
901269782 1:7942699-7942721 GAGAGTGGCCAGGGAGAGAGAGG - Intronic
901303592 1:8217092-8217114 GAGGGAGGCGAGGGAGCAGAAGG + Intergenic
901731865 1:11285779-11285801 GAGAATGGCCTCGGTGCTGAGGG - Exonic
902515974 1:16989855-16989877 CAGGGCGGCCAGGGAGCTGGGGG + Intronic
902603575 1:17556189-17556211 GAGAGGGGCCTGGGAGCACAGGG + Intronic
902697619 1:18150868-18150890 AAGAGTGGCCCCTGAGCTGATGG + Intronic
902733468 1:18384675-18384697 GGGAGAGGCCAGGGAGCAGAGGG + Intergenic
902931546 1:19735008-19735030 GTGAGTGGTCAGGAAGATGAAGG - Intronic
902936938 1:19771378-19771400 GCGAGCGGCCTGGGAGGTGAAGG - Exonic
903336690 1:22629141-22629163 GAGAGTGGCCAGGGAGAGCCTGG - Intergenic
903999919 1:27333065-27333087 GTGAGTGGCAGGGAAGCTGATGG - Intronic
904072431 1:27811794-27811816 GAGAGTGCCCTGGAAGATGATGG + Intronic
904194985 1:28778524-28778546 GAAAGGGGCCAGGGAGTTGATGG - Intergenic
904494757 1:30880341-30880363 GAGGGAGGCCAGGGGGCAGAGGG + Intronic
904566670 1:31432201-31432223 GAGAGTGGACAGGGTGGAGAGGG + Intronic
904605518 1:31695810-31695832 GGGAATGGGCAGGGAGCTCAGGG + Intronic
904641341 1:31932872-31932894 GACAGTGGCCAGGGAGTCAAGGG + Intronic
904832025 1:33311564-33311586 GAGAGGGGCTGGGGAGCTGAAGG - Intronic
904873223 1:33634844-33634866 GTGAGTGGCCAAGGAGCAGGAGG - Intronic
905349895 1:37338166-37338188 GAGAGAGGAAAGGGAGCTCAGGG + Intergenic
905936575 1:41828775-41828797 GAGACTGGCCAGGGTGCAGGGGG - Intronic
906104686 1:43284797-43284819 GGGCGTGGCCAGGGAGCAGGAGG - Intronic
906209169 1:44002722-44002744 GAGAGGGACCAGGGGGCTGGTGG - Intronic
906612468 1:47212915-47212937 GAGAGAGGCCAGGGCACAGAAGG - Intergenic
906678004 1:47707667-47707689 GAGACTCCCCAGGGAACTGAAGG - Intergenic
906703544 1:47877335-47877357 GAGAGTGGCCAAGCAGGGGATGG + Intronic
907312108 1:53544645-53544667 GAGAGGGACCAGGGAGCTTGGGG - Intronic
907944303 1:59119961-59119983 GACAGTGACCAGGGAGTTTATGG - Intergenic
908241727 1:62194422-62194444 GGGAGAGGCCAGGGAGCAGTTGG + Intergenic
908478873 1:64517447-64517469 GAGAGTTGGCAGGGAGCTGTGGG + Intronic
912008572 1:104932829-104932851 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
913535880 1:119771698-119771720 GGGAGTGGCCAGGGATTTGGAGG - Intergenic
914398484 1:147293105-147293127 GAGAGTGTCAAGGGAGCTTCCGG - Intronic
915526821 1:156481091-156481113 GGGAGGGGCCAGGGAGATGCTGG - Intronic
915528625 1:156490759-156490781 GAGACTTGCCAGGGAGAAGAGGG - Intronic
915564478 1:156706068-156706090 GAGAGGGGCTTGGGAGCTGCGGG + Intergenic
915982311 1:160427961-160427983 CAGAGTGGCGAGGTAGGTGAAGG - Exonic
916011206 1:160707559-160707581 GATAGTGGGCAGGAAGTTGAAGG + Intronic
916570779 1:166025453-166025475 GAGAGGGACAAAGGAGCTGAGGG - Intergenic
917435964 1:175021675-175021697 GAGAGGGGCCAGAGAGTTGATGG - Intronic
917495741 1:175538628-175538650 GAGACTGTCCAGGGTGCTGGAGG + Intronic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
918241994 1:182628872-182628894 GAGGGAGGCCAGGGTGCTGTTGG - Intergenic
919013962 1:192004608-192004630 GAGAGAGACCTGGAAGCTGAAGG + Intergenic
919659889 1:200234065-200234087 GAGAGAGGCTGGGGAGATGACGG - Intergenic
919699892 1:200620878-200620900 GAGCGTTGCCTGGGAGATGAGGG - Intergenic
920263171 1:204703453-204703475 AAGAGTGTGCAGGGAGCTGGAGG - Intergenic
920688862 1:208130695-208130717 GAGAGTGGCCGGGGAGGAGTAGG - Intronic
921046929 1:211484463-211484485 GAGAGTGGCTTGGCAGCAGAGGG + Intronic
921055795 1:211541557-211541579 GAGAGTGGTCAGGGAAGTGAAGG - Intergenic
921101254 1:211931264-211931286 CAGAATAGCCAGGGAGCTGATGG + Intergenic
921460174 1:215415784-215415806 GAGAGTAGGAAGGGAGCTGCTGG - Intergenic
921462805 1:215448861-215448883 GAGAGTAGGAAGGGAGCTGCTGG + Intergenic
922565184 1:226597017-226597039 GGGAGTGGCCAGGGACAGGAAGG + Intronic
922572409 1:226641945-226641967 CAGGGTGGCCGTGGAGCTGATGG + Exonic
923526795 1:234778937-234778959 GTGAGAGGCCAGGGAGCCCATGG - Intergenic
924618628 1:245639093-245639115 AAGAGAAGCCAGGGAACTGATGG - Intronic
924808219 1:247378627-247378649 GGCAGTGGTAAGGGAGCTGATGG + Intergenic
1064134220 10:12736729-12736751 GAGAGCGGCCAGGGAGATGGTGG - Intronic
1064230002 10:13521549-13521571 CAGTGGGGCCAGGGTGCTGAAGG + Intronic
1064934081 10:20660655-20660677 GAGAGAGGACAGGGGGCTGGGGG + Intergenic
1065194925 10:23255089-23255111 GGAAGTGGCCAGGGAGAGGAGGG + Intergenic
1065448225 10:25824685-25824707 GAGAGAGCACAGGGAGCTGCAGG + Intergenic
1067306731 10:45071501-45071523 GAGAGTGGCGGGGTAGCTTAGGG - Intergenic
1067451636 10:46385327-46385349 GAGGGAGACCAGGGAGGTGAGGG - Intronic
1067585603 10:47474429-47474451 GAGGGAGACCAGGGAGGTGAGGG + Intronic
1068545049 10:58335339-58335361 GGGTGCGGGCAGGGAGCTGAAGG + Intronic
1068919209 10:62465300-62465322 GAGGGAGGCCAGGGTACTGAGGG + Intronic
1069104151 10:64361896-64361918 GAGAGAGGATAAGGAGCTGAAGG + Intergenic
1069699483 10:70411499-70411521 GAGAGTGGAAATGGAGATGAAGG - Intronic
1069902949 10:71716278-71716300 GAGAAAGGCGAGGGGGCTGATGG + Exonic
1070157850 10:73847190-73847212 GCTAGTGGCCAAGGAGCTCAGGG - Intronic
1070159778 10:73859257-73859279 GACAGTGGCCAGCGGGCTGCAGG + Intronic
1070806992 10:79276504-79276526 GAGGGTGGCCAGGGTGGTGGGGG - Intronic
1071208901 10:83315532-83315554 GAGAGTGGAAGGGGGGCTGAGGG - Intergenic
1071602051 10:86963099-86963121 AAGGGTGGCCAGGGAGACGAGGG - Exonic
1072626471 10:97115560-97115582 GAGAGCCATCAGGGAGCTGAGGG - Intronic
1072714976 10:97744926-97744948 AAGAGAGGCCAGGGAGGTGGGGG + Intronic
1073374414 10:103020713-103020735 GAGAGGGGAAAGGGAGTTGAGGG + Intronic
1073415204 10:103375343-103375365 TAGATTGGCTAGGGAGGTGAGGG + Intronic
1073435232 10:103512294-103512316 GGGAGTGGGCAAGGAGCTGATGG + Intronic
1073650477 10:105353130-105353152 GAACGTGGCCAGAGAGGTGATGG - Intergenic
1073845036 10:107544962-107544984 GAGGGAGGCCAAGGGGCTGAGGG + Intergenic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1074858239 10:117489368-117489390 GAGAGCTCCTAGGGAGCTGATGG - Intergenic
1074979369 10:118607588-118607610 GAGGGTGGACAGGGAGAGGAGGG - Intergenic
1075648107 10:124109652-124109674 GAGAGTCCCCAGGGAGTTGGGGG + Intergenic
1075735330 10:124661363-124661385 GAGAGAGGCCCAGGAGCAGAAGG + Intronic
1076107555 10:127835348-127835370 GAGAGTGGCCAGGCAGCCTGCGG + Intergenic
1076156248 10:128207771-128207793 GGGAGGGGGCAGGGAGCTGTGGG - Intergenic
1076652030 10:131996623-131996645 GAGAGGGACAAGGCAGCTGAGGG - Intergenic
1076697383 10:132253490-132253512 GAGGGAGTCGAGGGAGCTGAGGG + Intronic
1076712414 10:132345662-132345684 GAGTGGGGGCAGGTAGCTGAGGG + Intronic
1077109259 11:854868-854890 AAGAGAGGCCTGGGAGCTGAAGG - Intronic
1077338164 11:2014578-2014600 CAGAGGGCACAGGGAGCTGAGGG - Intergenic
1078249287 11:9603739-9603761 GAATGAGGCCAGGGAGCTAATGG + Intergenic
1078557605 11:12342920-12342942 GGGAGGGGGCAGGGAGCTGATGG + Intronic
1078926635 11:15881057-15881079 GAGTGAGGCATGGGAGCTGAAGG - Intergenic
1079408321 11:20163898-20163920 GAGGGGGGGCAGGGAGCTAACGG + Intergenic
1079414159 11:20217408-20217430 GAGAGTGGCTTAGGAGATGATGG - Intergenic
1080485680 11:32704494-32704516 GAGGGAGGCCAGAGGGCTGAGGG + Intronic
1080896678 11:36453965-36453987 CAGAGTTGCAAGGAAGCTGATGG + Intronic
1083029285 11:59577209-59577231 GAGTGATGCCAGGGAGCGGATGG - Intronic
1083087766 11:60168241-60168263 GACAGTGGCCAGGGAACCAAAGG + Intergenic
1083148562 11:60775943-60775965 GACAGGGCTCAGGGAGCTGAAGG - Exonic
1083307014 11:61766493-61766515 GAGAGTGGACAGGAAGCGGCGGG + Intronic
1083659164 11:64244316-64244338 GAAAGTGGCTGGGGAGCTGTGGG - Intergenic
1083812923 11:65115689-65115711 GAGAGTAGTCAGAGAGCTGGGGG + Intronic
1084171769 11:67404390-67404412 GACAGAGGACAGGGGGCTGAGGG + Intronic
1084196577 11:67526109-67526131 GACAGTGGCCAGGGAAGTGCAGG + Intergenic
1084319441 11:68365310-68365332 GAGGGTGGCCAGGAAGGTCACGG + Intronic
1084364731 11:68690223-68690245 GAGAGTTAACAGGGAGCTGGTGG + Intronic
1084675538 11:70631751-70631773 GAGAGAGGCCGGGGAGGTCAGGG - Intronic
1084946214 11:72640031-72640053 GAGGATGGCCAGTGAGCTGGCGG - Intronic
1085286341 11:75364101-75364123 CAGAGTGGGCAGGGATATGATGG - Intergenic
1085523543 11:77151719-77151741 GAGATTGGCCAGAGGGCTCAGGG + Intronic
1086350699 11:85941217-85941239 GAGAGCGGCCAGGGAGCCGAAGG - Intergenic
1087252891 11:95923808-95923830 GAGAGGGGCCGGGGACCTGCTGG - Intronic
1087711179 11:101554573-101554595 GAAACTGGCCAGGGCACTGAAGG - Intronic
1089159794 11:116428678-116428700 GTGAGTGGCCAGGGAGAAGATGG + Intergenic
1089181018 11:116582879-116582901 AAGAGAGGCTAGGGAGCCGATGG + Intergenic
1089309811 11:117550638-117550660 GTGCGTGTCCAGGGAGCTGGCGG - Intronic
1089345942 11:117791809-117791831 GAGAGGGGGCAGGGAGAGGAAGG + Intronic
1089650740 11:119911110-119911132 GACACTGGCCATGGAACTGAAGG + Intergenic
1089775751 11:120834615-120834637 CAGAGTGGGCAGGGAGCACACGG + Intronic
1089810752 11:121129512-121129534 GAGAGAGGTCAAGAAGCTGATGG - Intronic
1090593781 11:128298721-128298743 CAGAGTGGTCAGGGAGATGATGG - Intergenic
1090655678 11:128842732-128842754 GAGCGTGGCCAAGGAGAGGAAGG - Intronic
1091194265 11:133718277-133718299 GGGGGTGGGCAGGGATCTGAAGG - Intergenic
1202821148 11_KI270721v1_random:69760-69782 CAGAGGGCACAGGGAGCTGAGGG - Intergenic
1091386756 12:100893-100915 GGGAGGGGCCAGGGAACTCAGGG - Intronic
1091663065 12:2398933-2398955 GACAGTTGCCAGGGCACTGAGGG - Intronic
1091969192 12:4771733-4771755 GAGAGAGGGCCGGGAGCAGAGGG + Intronic
1092234343 12:6796900-6796922 GAGAGGGCTCAGGGAGGTGATGG - Intronic
1092282964 12:7110933-7110955 GAGACTGGAGAAGGAGCTGATGG + Intergenic
1092735617 12:11579647-11579669 GAGAATGGAGAGAGAGCTGAAGG + Intergenic
1093183084 12:15988843-15988865 GAGAAAGGCCAAGGGGCTGAGGG - Intronic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1096562539 12:52447145-52447167 GAGAGGGGCCTGAGAGCTGTGGG + Exonic
1096633500 12:52944582-52944604 GGGCTGGGCCAGGGAGCTGAGGG + Intronic
1096915403 12:55026869-55026891 GAGACTGGCCAGACACCTGAAGG + Exonic
1097185471 12:57194197-57194219 GAGAGGGGGCAGTGAGCAGATGG + Intronic
1097712683 12:62933683-62933705 AAAAGTGGCCATGGAGCTGGGGG + Intronic
1097713135 12:62936385-62936407 GAGAGTGGCCCAGGTGTTGAAGG + Intergenic
1097806567 12:63971050-63971072 GAGAGTGTCTAGAGAGCTCAGGG - Intronic
1097913462 12:64995205-64995227 GAGGGAGGAGAGGGAGCTGAAGG + Intergenic
1098227714 12:68341862-68341884 GAGTATGGATAGGGAGCTGATGG + Intergenic
1099468705 12:83019793-83019815 GAGAGTGGAATGGGAGCAGAAGG - Intronic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1100399545 12:94217003-94217025 GAGAGGAGCCAGTGAGGTGAAGG - Intronic
1100406500 12:94276747-94276769 GAGAGAAGGCAGGGAGCTGGTGG - Intronic
1101819173 12:108169961-108169983 CAGGGTGGCCAAGAAGCTGAAGG + Intronic
1102010976 12:109618109-109618131 GGGAGTGGCCAGGGGGCAGCAGG - Intergenic
1102304156 12:111792105-111792127 GAGAGTGACCTTGGAGCTGGGGG + Exonic
1102868172 12:116390987-116391009 GAGAGTGACCATGGTGCTCATGG - Intergenic
1103149628 12:118625740-118625762 AAGAGAGGGCATGGAGCTGAGGG + Intergenic
1103665694 12:122563513-122563535 GAGAATGACCTGGGAGCTGTGGG - Intronic
1103667167 12:122577993-122578015 GAGAATGACCTGGGAGCTGTGGG + Intronic
1103745731 12:123122139-123122161 GAGATTCCCCAGGGAGCTGGGGG - Intronic
1104366969 12:128186883-128186905 GAGACTGACCAGGGCCCTGAGGG + Intergenic
1104856249 12:131903797-131903819 GGGAGTGGGCAGGGGGCTGTGGG - Intronic
1104925483 12:132311869-132311891 GAGAGGGGCAAGGGAGCTGGTGG - Intronic
1105428182 13:20313675-20313697 GACTGTGGCCACGGATCTGAGGG - Intergenic
1105812663 13:24008742-24008764 GGGGGTGGACAGGGAGCTGGGGG - Intronic
1106016975 13:25878865-25878887 GAGAGTGGGAAGGCAGCTGATGG - Intronic
1106482014 13:30143689-30143711 AAATGTGGCCAGGGAACTGATGG + Intergenic
1106811168 13:33359699-33359721 AAGAATGGCAAGGGAGCTGTGGG - Intergenic
1107229010 13:38086144-38086166 GAAGGAGGCCAGGGGGCTGAGGG + Intergenic
1107435010 13:40374312-40374334 GTGAATGGCCATGGAGTTGATGG + Intergenic
1110305688 13:73984452-73984474 CAGAGAGGCCAGGGAACTGTGGG - Intronic
1110777606 13:79427534-79427556 GAGATTGGACAGGCAGCTGCTGG - Intergenic
1111347263 13:86974760-86974782 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
1113340617 13:109421410-109421432 GAGGCGGGCCAGGGGGCTGAGGG - Intergenic
1113376837 13:109772130-109772152 GAGGGTGGCCACTGAGATGACGG + Intronic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1115499107 14:34033750-34033772 GAAAGTGGCAAGGGAGCTAAAGG - Intronic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1117374510 14:55108334-55108356 GAGAGGAGCAAGGGAGCAGAAGG + Intergenic
1117552656 14:56851508-56851530 GAGAGGAGCAAGGGAGTTGAGGG + Intergenic
1118817177 14:69321821-69321843 CAGAATGGCCAGGGCGCTGTTGG + Intronic
1119415171 14:74465049-74465071 GAGAGTGCCCAGGGAGGAGCAGG - Intergenic
1120592274 14:86390380-86390402 GAGGGAGGCCAGTGGGCTGAGGG + Intergenic
1121332115 14:93056173-93056195 GAGAGTGGCCTGGGTGCAGCAGG + Intronic
1121814755 14:96920683-96920705 GAGGGTGGCCTGGGAGCTGCTGG - Intronic
1122152400 14:99732086-99732108 GGGAGGGGGCAGGGAGGTGATGG - Intergenic
1122873352 14:104651371-104651393 GGCAGGGGCCAGGGAGGTGAGGG - Intergenic
1122943933 14:104996460-104996482 GAGTGGGGGCAGGGAGCTGACGG + Intronic
1123028312 14:105438965-105438987 TAGAGTGGGCAGGCAGCTCAGGG - Intronic
1124372367 15:29110977-29110999 CCGAGTGGCCAGGAAGCTGAGGG + Intronic
1124718112 15:32085897-32085919 ACGACTGGCCAGGGAGCAGATGG - Intronic
1125001114 15:34770785-34770807 GAGGCAGACCAGGGAGCTGATGG - Intergenic
1126856100 15:52840912-52840934 GAGAGCTGCCAGGAATCTGAGGG + Intergenic
1127561161 15:60137775-60137797 CAGAGTGGGAAAGGAGCTGATGG + Intergenic
1128668555 15:69557018-69557040 GAGGGTGGTCAGGGAGGAGAGGG + Intergenic
1129161563 15:73750977-73750999 GGAGGTGGCCAAGGAGCTGAGGG - Exonic
1130980366 15:88808148-88808170 GCCAGAGACCAGGGAGCTGAGGG - Intronic
1131056783 15:89379506-89379528 GAGAGTGGCCAGGGAGCCGTGGG + Intergenic
1131232095 15:90666802-90666824 GAGGGTGGCCAGGCAGCTCCTGG + Intergenic
1131306427 15:91247844-91247866 GAGGGTGGCTTTGGAGCTGAGGG + Intronic
1131568345 15:93506567-93506589 GAGGGAGACCAGGGGGCTGAGGG - Intergenic
1131867873 15:96731330-96731352 TAAAGTGGGCAAGGAGCTGACGG - Intergenic
1132141689 15:99402416-99402438 GAGAGTAGCGAGGGAGGGGAGGG + Intergenic
1132196715 15:99919166-99919188 GAAAGTGGCCAATCAGCTGAAGG - Intergenic
1132466749 16:81144-81166 GAGAGTGGCCTGGGATTTCATGG - Intronic
1132584922 16:701946-701968 GAGCCTGGCCTGGGAGCTGCTGG + Intronic
1132670379 16:1100044-1100066 GAGAGAGCCCAGAGACCTGAAGG + Intergenic
1132686270 16:1163405-1163427 GGGAGTGTCCAGTGAGCTGCCGG + Intronic
1132953522 16:2578411-2578433 GAGGATGTCCAGGGAGCTGACGG + Intronic
1132960830 16:2621756-2621778 GAGGATGTCCAGGGAGCTGACGG - Intergenic
1133018513 16:2955747-2955769 GAGGGTGGCCAGGACTCTGAGGG + Intergenic
1133775235 16:8890227-8890249 GAGTGAGGCCTGGGAGCTGGAGG - Intergenic
1134042821 16:11081303-11081325 TAGAGTGGAGAGGGGGCTGAGGG - Intronic
1134136394 16:11679260-11679282 GGGAGCTGCCAGGGAGCTGGGGG + Exonic
1134418103 16:14062007-14062029 GAGAGTGGCCAGGGCTTTGTGGG + Intergenic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1135961513 16:26998382-26998404 GAGAAAGGCCAGGGAGCTGATGG + Intergenic
1136097246 16:27965952-27965974 GAAAGAGGTCAGGGAGGTGATGG - Intronic
1136655204 16:31705493-31705515 GAGATTGGGCAGGGGGCAGAGGG + Intergenic
1138116403 16:54364137-54364159 GGGAGTGGGCAGTGAGCGGAAGG - Intergenic
1139361594 16:66403039-66403061 GTCGGTGCCCAGGGAGCTGAGGG - Exonic
1139384895 16:66560635-66560657 GAGAGTGTAGAGAGAGCTGAAGG + Intronic
1139504568 16:67392532-67392554 GGGTGTGGCCAGAGGGCTGAGGG - Intronic
1139549264 16:67664458-67664480 GAGTGTGTCCAGGAAGCAGATGG - Intronic
1139556928 16:67718471-67718493 AAGAGTGGACAGGGACATGAGGG - Intronic
1140922865 16:79554876-79554898 GAGAGATGCCAGGGCTCTGATGG - Intergenic
1141548651 16:84789374-84789396 GAGAGGGGCGCGGGAGGTGATGG + Intergenic
1141678811 16:85531933-85531955 CAGATTCCCCAGGGAGCTGATGG + Intergenic
1141873304 16:86804483-86804505 GACAGAGGCCATGGAACTGAGGG + Intergenic
1142117712 16:88368656-88368678 GAGAGTGGCCTGGGAGACCATGG + Intergenic
1142500172 17:327908-327930 GGGAGGGGGCAGGGAGCAGATGG - Intronic
1143126648 17:4645700-4645722 GAGAGTGGGGAGGGAGGAGACGG - Intergenic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143178675 17:4970887-4970909 GAGAGTTGAAAGGGAGCTGGGGG - Intronic
1143407286 17:6685917-6685939 GAGGGAGGCCAGGTAGCCGAGGG - Exonic
1143635801 17:8163130-8163152 GCGAGTGCCGAGGGAGCTGCCGG - Intronic
1144038919 17:11391216-11391238 GAGGGTGGGCAGGAAGGTGATGG + Intronic
1144137795 17:12314853-12314875 GGGAGTGAACAGGGAGCTCATGG - Intergenic
1144698467 17:17321579-17321601 GAGAGCTGCCAGGCAGCTGCAGG + Intronic
1144729271 17:17517445-17517467 GAGGGAGGGCATGGAGCTGATGG - Intronic
1144853801 17:18257427-18257449 GTGAGTTGCCAGTGTGCTGATGG - Intronic
1145762477 17:27433710-27433732 GACAGTGGCCAGGGTGAGGATGG - Intergenic
1145924118 17:28633185-28633207 GTGAGTGACCAGGGCACTGAGGG - Intronic
1146213224 17:30958022-30958044 GGGAAGGCCCAGGGAGCTGATGG - Exonic
1146410509 17:32579656-32579678 GAGAGTGGATAGGGAGGGGAAGG - Intronic
1146638949 17:34525943-34525965 CAGAGGGGGCAGGAAGCTGAGGG + Intergenic
1147018664 17:37512922-37512944 GAGAGTGGAGAGGGAGCAGACGG - Exonic
1147403612 17:40195333-40195355 GGGAGGGGGCAGGGAGCAGAAGG - Exonic
1148398440 17:47330449-47330471 GAGAGGGGACAGGGAAGTGAAGG - Intronic
1148911859 17:50947168-50947190 GAGAGGGGGCAGGGCGCTGGAGG + Intergenic
1148945560 17:51259739-51259761 GAGCGGGGTCAGGGAGCTGCGGG + Intronic
1149243723 17:54680942-54680964 GAGAGTGGCCAGGGAATTACTGG - Intergenic
1149995926 17:61405872-61405894 GAGAAGGCCCAGGGAGCTGGCGG + Intronic
1152253869 17:79226177-79226199 GAGAGTGGGCAGGCAGCAGTGGG + Intronic
1152358832 17:79820608-79820630 GAGAGTGACCTGGGGGCCGAGGG + Intergenic
1152565468 17:81098291-81098313 GAGAGTGGCGAAGAAGCTGAGGG - Intronic
1152610265 17:81311899-81311921 GAGCGGGGCCTGGGAGCTGAGGG - Exonic
1152626360 17:81389531-81389553 GACAGTGACCAGGGGGCTGGAGG + Intergenic
1152655663 17:81518149-81518171 GACGGTGGTCAGGGCGCTGAAGG - Intronic
1153568520 18:6445017-6445039 GGGAGTGGTCAGGGAGCTTTAGG - Intergenic
1154325973 18:13390622-13390644 GAGAGAGGCCAGGGTGCTTGAGG + Intronic
1157220269 18:45824593-45824615 GAGAGTGACCAAGAAGTTGAAGG + Intergenic
1157546221 18:48548451-48548473 GAGAGTGCCCAGGGTACTGTAGG - Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1159563144 18:70017114-70017136 GAGAGAGGAGAGGGAGCAGAAGG + Intronic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1160109383 18:76011508-76011530 GAGAGACCCCAGGGAGCAGAAGG + Intergenic
1160396028 18:78572778-78572800 GAGAAAGGCCAGAGAGCTGGTGG + Intergenic
1160405504 18:78643840-78643862 GAAAGTGGCCCAGGAGCAGAGGG + Intergenic
1160431963 18:78818986-78819008 GAGACTGGCCAGGGAGATGCAGG + Intergenic
1160812815 19:1020329-1020351 GAGAGAGGCCTCGGAACTGAGGG + Intronic
1161321282 19:3642804-3642826 GAGAATGGGCAGAGAGCAGAGGG + Intronic
1161566233 19:5004394-5004416 GAGAAGGGCCAAGGAGCTGGCGG - Intronic
1161605894 19:5214748-5214770 GCGAGAGGCCAGGGATCTGTGGG + Intronic
1161668394 19:5590570-5590592 GAGGGGAGCCAGGGAGCAGAGGG - Intronic
1161699428 19:5786830-5786852 GAGAGCGGCCGTGGAGCTGGGGG + Exonic
1161939787 19:7395197-7395219 GAGAGTGGCAGAGGAGCTGGCGG + Intronic
1161951468 19:7470218-7470240 GGCAGTGGCGAGGGAGCTGGGGG - Exonic
1162057677 19:8074432-8074454 GAGAGTGTCCAGGAGCCTGAAGG + Intronic
1162528632 19:11222564-11222586 GAGAATGGCAAGAGAGGTGAAGG + Intronic
1163050210 19:14677510-14677532 GAGAATGGCCAGAGAGATGAGGG + Intronic
1163817102 19:19473354-19473376 GTGCTTGACCAGGGAGCTGAAGG - Intronic
1163837155 19:19581970-19581992 GAGAGTGCCCTGGGATGTGAAGG + Intronic
1163839178 19:19595429-19595451 GAGTGCTGCCAGGGAGTTGAGGG + Intronic
1163849525 19:19655317-19655339 GAGCTTGGCCAGGGCGATGAGGG + Exonic
1164149715 19:22540806-22540828 GAGAGGGGAGAGGGAGCAGAGGG + Intergenic
1164158220 19:22609557-22609579 CAGAATGCCCAGGGAGCGGAGGG - Intergenic
1164515358 19:28930716-28930738 GAGAGTGGGCAGAGAGCTTTGGG - Intergenic
1164570595 19:29371895-29371917 GGGAGTTGCCAGGGACCTGGGGG + Intergenic
1164656354 19:29924788-29924810 GAGCCTGGACAGGAAGCTGAGGG - Intronic
1165072828 19:33265436-33265458 TACAGTGGCCAGGGAGAGGAAGG + Intergenic
1165158912 19:33804498-33804520 GAGAGTTCCCAGGAGGCTGAGGG + Intronic
1165347426 19:35257652-35257674 GAAAGAGGCCGGGAAGCTGAGGG + Intronic
1165392514 19:35546588-35546610 GAGAGGGGCCAGGGAAGGGAAGG + Intronic
1165642154 19:37398760-37398782 GAGAGAGGCCAGGGTGCCCATGG - Intergenic
1165803538 19:38566988-38567010 GTGAGTGGCCTTGGGGCTGAGGG + Intronic
1165843160 19:38801638-38801660 AAGAGTAGCCGGGGAGCAGATGG + Intergenic
1165866611 19:38943154-38943176 GAGAGGGGTCAGGGAGGTCATGG + Intronic
1165941512 19:39416843-39416865 GAGCAGGGCCAGGGAGCTGGGGG - Exonic
1166863433 19:45822590-45822612 GAGGGTGGCCTGGGAGCTCCGGG + Intronic
1166924852 19:46260498-46260520 GAGGGACGCCTGGGAGCTGAGGG + Intergenic
1167135405 19:47612631-47612653 GAGAGGGGCTGGGGGGCTGACGG + Intronic
1167138729 19:47634413-47634435 GAAAGTGGCCAGGTAGAGGAAGG + Intronic
1167472801 19:49684844-49684866 GAGCGCGGCCCGGGAGCTGGCGG + Intronic
1167618693 19:50549708-50549730 GAGGGTGGCTGGGGACCTGACGG + Intronic
1167635866 19:50655251-50655273 GAGAGAGACCAGTTAGCTGATGG + Intronic
1167795514 19:51705633-51705655 GAGAGAGGCCAAGGAGGTGGTGG - Intergenic
1167836038 19:52070835-52070857 GAGAGTAGCATGGGAGGTGAGGG + Intronic
1167972626 19:53197946-53197968 TAGAGGGGCTTGGGAGCTGAAGG - Intergenic
1168507157 19:56945932-56945954 GAGTGTGGCCAGGGGACTGGAGG + Intergenic
925109251 2:1319601-1319623 CACAGAGCCCAGGGAGCTGAGGG - Intronic
925148373 2:1598382-1598404 GGGAGGTGCCAGGCAGCTGATGG + Intergenic
926079020 2:9968680-9968702 AAGAGAGGCCTAGGAGCTGAGGG + Intronic
926241564 2:11092899-11092921 GCAAGTGGGCATGGAGCTGAGGG - Intergenic
926306818 2:11643243-11643265 GGCAGGGTCCAGGGAGCTGATGG - Intergenic
927843337 2:26458658-26458680 GAGAGTGGGCAGGTCGGTGAGGG - Intronic
927957677 2:27219192-27219214 GAGACTGTCCAGGGATCTGAAGG - Intronic
928094885 2:28398450-28398472 CAGAGCCGCCAGGGAGCTGTGGG + Intronic
929002928 2:37366028-37366050 GAAAGGGGCAAGGGAGTTGAGGG + Intronic
929536350 2:42786761-42786783 GAGCCGGGCCAGGGAGCTGGAGG + Intronic
930817166 2:55610067-55610089 GAGTCTGGCCAGGAAGGTGATGG - Intronic
931252793 2:60549311-60549333 GAGAGCTGCCGGGGAGCGGAGGG + Intronic
931878666 2:66542753-66542775 TAGAGTGGCCAAGGTGGTGAGGG + Intronic
931984822 2:67731204-67731226 GAGGTGGGGCAGGGAGCTGATGG - Intergenic
932769052 2:74490294-74490316 GACAGGGGCAAGGGGGCTGAGGG + Exonic
932950853 2:76291309-76291331 GAGAGAGCCCAGGGAGTTGGAGG + Intergenic
935946173 2:108288661-108288683 GGGAGGGGCCAGGCAGCTGAGGG + Exonic
936022103 2:109002625-109002647 GAGGGTGGCCGGGGAGCAGAGGG - Intergenic
936166233 2:110122118-110122140 AAGTGTGCCCAGGCAGCTGATGG + Intergenic
937308071 2:120884429-120884451 GAATGGGGCCAGGGAGGTGAGGG - Intronic
937370874 2:121296436-121296458 GAGGGAGGCCAGGGGCCTGAGGG - Intergenic
937991125 2:127663162-127663184 GCGAGTGGCCAGGGCACTGATGG - Intronic
939084998 2:137708249-137708271 GAGGGAGCCCAGGGGGCTGAGGG - Intergenic
939394415 2:141610465-141610487 GAGAGTGGCAAGGGGGCTGTAGG - Intronic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940398754 2:153222643-153222665 GAGGGAGGCCAGTGACCTGAGGG - Intergenic
940927055 2:159375777-159375799 CAGAGGGGCAAGGGAGATGATGG + Intronic
942058856 2:172209477-172209499 GAGAATGGCCAGGAAGCACACGG - Intergenic
943247374 2:185473145-185473167 GAGGGAGGCCAGGGGGCTGAGGG + Intergenic
945219387 2:207468589-207468611 GAGAGTGCCCAGGGAGGGCATGG - Intergenic
946413267 2:219526281-219526303 GAGAGGGGCCAGGGAGAAGGAGG + Intronic
946448712 2:219761728-219761750 GAGGATGGCCAGGGAGCAGGTGG - Intergenic
948676571 2:239600511-239600533 CAGAGTGGGAAGGGGGCTGAGGG + Intergenic
1169249638 20:4050462-4050484 TAGAGTGGGCTGGGAGCTGTTGG - Intergenic
1170096453 20:12650733-12650755 GAGAATGGCCGGGGAGCTAGCGG + Intergenic
1170547727 20:17449311-17449333 GAGGGTGGCCCTGGAGCTGAAGG - Intronic
1170611166 20:17914895-17914917 GAGAGGGGCCAGGGAGCTGAAGG + Intergenic
1170758704 20:19230193-19230215 GAGAGTGGTGAGGGCGCTGAAGG - Intronic
1171020573 20:21581012-21581034 GAAAGTGGCCAGAGGGCTGGGGG - Intergenic
1171141972 20:22751120-22751142 GGGTGGGGCCAGGGAGTTGAGGG + Intergenic
1171499189 20:25579952-25579974 AAGAGTGGTCAGAGACCTGAGGG - Intronic
1172304774 20:33873053-33873075 TGGAGTGGGCAGGGAGCAGAGGG - Intergenic
1172658060 20:36548990-36549012 AAGAGCTGCCAGGGGGCTGAGGG + Intronic
1172979372 20:38929321-38929343 GAGAGTGGACAGTGTGCTGATGG + Intronic
1173602216 20:44303950-44303972 GGGAGTGGCCATGGAGTAGATGG - Exonic
1174189064 20:48727389-48727411 GAGAGAGGCAAGGGGGCTGCAGG - Intronic
1174602493 20:51736038-51736060 ATGGGTGGCCAGGGAGGTGAGGG + Intronic
1174643786 20:52068039-52068061 GGGAGGGGCGAGGGAGCTGGAGG - Intronic
1174681733 20:52415259-52415281 GGGAGTGGACAGGGAGCAGAAGG - Intergenic
1174962326 20:55172512-55172534 GAGATTGGACAGGCAGCTGTTGG - Intergenic
1175443087 20:59004341-59004363 AGGAGTGGCCAGGGAGGTGGAGG + Intronic
1176222352 20:63975654-63975676 CAGAGAGGCCTGGGGGCTGATGG - Intronic
1176369191 21:6052352-6052374 GAGACTGGCCTGGGTGCTCAGGG - Intergenic
1177046150 21:16172742-16172764 GAGAGAGGCGAGGAAGCTGCAGG - Intergenic
1178289754 21:31357033-31357055 AAGATGGGCCAGGGAGTTGAGGG - Intronic
1178397943 21:32259215-32259237 GAGAGTGGCCAGGGGCTCGAGGG + Intergenic
1178431500 21:32522196-32522218 GAGTGTGGCCAGGGGACGGAAGG - Intergenic
1178584725 21:33862502-33862524 GAGAGAGGGCATGGAGCAGATGG + Intronic
1178760101 21:35393978-35394000 TCATGTGGCCAGGGAGCTGAGGG - Intronic
1178940734 21:36902887-36902909 GAGAGGAGGCAGTGAGCTGAAGG + Intronic
1179167221 21:38944481-38944503 GAGGGTGGAGAGGGCGCTGATGG - Intergenic
1179220019 21:39398362-39398384 GAGCGTGCCCAGGGAACTGCTGG + Intronic
1179381517 21:40903502-40903524 GAGAATGGCCAGGGATTAGATGG - Intergenic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179608409 21:42533195-42533217 GAGAGAGGCCAGGGGTCTGGAGG - Intronic
1179648820 21:42793362-42793384 AAGAGTGTCCAGGGAGCAGCTGG - Intergenic
1179754328 21:43486189-43486211 GAGACTGGCCTGGGTGCTCAGGG + Intergenic
1180246832 21:46554219-46554241 GAGAGTGGCCGCGGCTCTGATGG + Exonic
1180632201 22:17237405-17237427 GGGACTGGCCAGGGAGCCGGAGG + Intergenic
1180903796 22:19394319-19394341 GTGAGTGCCCAGGGAACTAAAGG - Intronic
1181266549 22:21634147-21634169 GAAAGTGGCCAAAGGGCTGAGGG - Exonic
1181477170 22:23175925-23175947 GGGACTGGCCAGGGAGATGATGG - Intergenic
1181805945 22:25374539-25374561 GAGGGTGGCCAGGAAGGTCACGG - Intronic
1182522100 22:30890551-30890573 AGGAGGGGCCAGGGAGGTGATGG + Intronic
1182680316 22:32074328-32074350 GGGAGCCCCCAGGGAGCTGAGGG + Intronic
1182758973 22:32706738-32706760 GAGACTGGTCAGGGAGCAAAGGG - Intronic
1182762276 22:32732441-32732463 GGGAGTCACCAGGAAGCTGAAGG - Intronic
1182947078 22:34333785-34333807 GACAGTGGCCAGGGAGACTAAGG + Intergenic
1183589046 22:38769391-38769413 GAGCGTGGGCTGGGGGCTGAGGG + Intronic
1184037674 22:41926352-41926374 GAGGGAGGCCAGGGGGCCGAGGG + Intronic
1184128147 22:42501808-42501830 GAAAGTGGGCAGGAAGGTGAGGG + Intergenic
1184136937 22:42555121-42555143 GAAAGTGGGCAGGAAGGTGAGGG + Intronic
1184390354 22:44200130-44200152 GGGAGAGCCCAGGGAGCTGGAGG - Intronic
1184736124 22:46398647-46398669 GAGAGGGGCCGGGGATCTGGGGG + Intronic
1184747427 22:46464509-46464531 GGCAGGGGCCAGGGTGCTGAAGG - Intronic
1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG + Intergenic
949535095 3:4989364-4989386 GAAAGAGGCCAGTGAGGTGAAGG - Intergenic
950686297 3:14620836-14620858 GAGAGTAGGCAGGGAGGGGAAGG + Intergenic
951681662 3:25301279-25301301 GAGAGTCCCCAGGTAGCTGAGGG - Intronic
952173047 3:30830519-30830541 CAGAATGGCCAGGGAGATGGTGG - Intronic
952282710 3:31938916-31938938 GAGGGTGGGCAGGAAGTTGAAGG - Intronic
952822566 3:37498035-37498057 CTGGGTGGCCAGGGAGCTGTGGG + Intronic
953913429 3:46904162-46904184 GGGTGTGGCCAGGGACCCGAGGG - Intergenic
953944613 3:47135737-47135759 GAGAGTGGTCATGGAGATCATGG - Intronic
954801861 3:53191897-53191919 GAAAGTGACCAGGGAGCTCTGGG - Intronic
955233029 3:57115647-57115669 AAGAGTGGCCAGACAGCTCATGG - Intronic
955475661 3:59333527-59333549 GTGAGTGTGTAGGGAGCTGAAGG + Intergenic
955719774 3:61868431-61868453 CAGAGAGGCCAGGGAGCTGGGGG - Intronic
956021253 3:64935492-64935514 GAGAGTGGGGAGGGAGTTGTAGG + Intergenic
956750069 3:72338022-72338044 CAGAGAGGCCATGGGGCTGACGG - Intergenic
958013697 3:87914075-87914097 GAGATGGTCCAGGAAGCTGAAGG + Intergenic
959196137 3:103185293-103185315 GATACTGGCCATGGAACTGAGGG + Intergenic
959819933 3:110721159-110721181 GAGAGAGGCATGGGACCTGATGG - Intergenic
960619013 3:119621455-119621477 GAGAGTGGCTGGAGAGCTGCTGG - Intronic
960619506 3:119625080-119625102 GAGACTGGCCAGAGGGCAGAAGG - Intronic
961359382 3:126357415-126357437 GTGAGTGCCCAGCGAGCTGCGGG - Exonic
961433087 3:126897047-126897069 GAGAGTTGGATGGGAGCTGAAGG + Intronic
961787145 3:129354009-129354031 GTGAGATGCCAGGGCGCTGAGGG + Intergenic
961827304 3:129605902-129605924 GCGCGTGTCCAGGGAGCGGATGG + Exonic
962391588 3:134977220-134977242 GCGAGTGGCCTGGGATGTGAAGG + Intronic
966340539 3:178920849-178920871 GAGAGTGGCAAGGGGGGTGAGGG + Intergenic
968882969 4:3310558-3310580 AAGAGTGGCCAGGGACTTGGAGG + Intronic
969297142 4:6276872-6276894 GACAGTGGCCAAGGAGCAGGAGG - Intronic
969331340 4:6474827-6474849 GGGGGTGGGCAGGGGGCTGAGGG - Intronic
969457545 4:7308698-7308720 GAGAGAGGACAGGGTGCTGGTGG - Intronic
969464123 4:7344621-7344643 GAGAGTGGACACTGAGGTGAGGG + Intronic
969619480 4:8271920-8271942 GAGACTGCCCAGGAGGCTGAGGG + Intronic
969630097 4:8330855-8330877 GAGAGGGGCTAGGGAGCTGTGGG + Intergenic
969728500 4:8939700-8939722 GAGACTGGGAAGGGAGCTGCAGG - Intergenic
970585918 4:17514131-17514153 GAGAGTGTCAAGGAAGCAGAGGG - Intergenic
973337110 4:48967822-48967844 GAGACTAGACAGGGAGGTGAGGG + Intergenic
973959725 4:56097609-56097631 AAGAGAGGCTAGGGAGGTGAAGG + Intergenic
974965820 4:68759822-68759844 GAGAGGGGCCATGGGGTTGAGGG + Intergenic
976101188 4:81565644-81565666 GACTGTGGCCAAGGAGCTGTGGG - Intronic
976203486 4:82602148-82602170 GTGAGTGGGAAGGGAGCCGAAGG - Intergenic
978558650 4:110008209-110008231 GAGGATGGCCAGGCAGCAGATGG + Exonic
979597274 4:122547806-122547828 GAGAAAGGCCAGTAAGCTGAAGG - Intergenic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
984363678 4:178770863-178770885 GAGAAATGCCAGGTAGCTGAGGG - Intergenic
984534139 4:180952209-180952231 GTTAGTGGCCAGGGAGATGGGGG - Intergenic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
985812864 5:2103119-2103141 GAGGGTGGCCAGGCAGCAGGAGG + Intergenic
986216234 5:5721629-5721651 GAGACTTCCCAGGGACCTGATGG - Intergenic
986776243 5:11016618-11016640 GCAAGTGGCCAGGGGGCTGCAGG + Intronic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
990835897 5:60019645-60019667 GAGAGAGGTGAGGAAGCTGAAGG - Intronic
991954205 5:71976161-71976183 CAAAGTGGCCAGGGAGCTCATGG - Intergenic
993782137 5:92079995-92080017 GAGAGTCGCAAGAGAGATGAGGG - Intergenic
994590110 5:101761341-101761363 GACAGCAGCCAGGGAGCTGAAGG + Intergenic
994811735 5:104528025-104528047 GAAAGTGGCTAGGGAGATAAGGG + Intergenic
997520472 5:134520818-134520840 GAGAGTGGTCAGTGAGCAGATGG - Intergenic
997605393 5:135172376-135172398 GGCAGTGGGCAGGGAGCTGTAGG - Intronic
998132346 5:139657753-139657775 GGGACTGGCCTGGGAGGTGAGGG + Intronic
998352021 5:141508120-141508142 GAGGGAGGTCAGGGAGCTGGGGG + Intronic
998823124 5:146074758-146074780 GAGAGAGGGCAGAGGGCTGAAGG - Intronic
999740517 5:154546599-154546621 GAGAATGGCAAGGGAAATGAGGG - Intergenic
1000516522 5:162241645-162241667 GAGAGGGGGCAGGGAAGTGATGG - Intergenic
1001282170 5:170394199-170394221 GAGAGTGGCTAAGGGGCTGGGGG - Intronic
1001523998 5:172415695-172415717 TGGAGTGCCCAGAGAGCTGAGGG - Intronic
1001753325 5:174147822-174147844 CAGAGTGGCCAGCCTGCTGAGGG - Intronic
1002385495 5:178862691-178862713 GACAGTGGAGTGGGAGCTGAGGG + Intronic
1002414919 5:179115204-179115226 GAGATGGGCCAGGGAGAAGATGG - Intronic
1002456987 5:179350935-179350957 GAGATTGCCCAGGAAGCGGAGGG - Intergenic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1002913603 6:1510468-1510490 GAGTTTGGACTGGGAGCTGAGGG + Intergenic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007774458 6:44217159-44217181 GGGAGGGGCCAGGGAGCAGTAGG + Intergenic
1008440256 6:51524759-51524781 GGGAGTGCACAGGGAGTTGAGGG - Intergenic
1009307030 6:62103321-62103343 GCGACAGGCCAGGGGGCTGAAGG - Intronic
1009967808 6:70595217-70595239 AAGAGTAGCCTGGGAGCTGAAGG - Intergenic
1011777920 6:90752652-90752674 GAGAGTGGGAAGTGAGCAGATGG + Intergenic
1012182177 6:96167882-96167904 ACGAGTGGCCAGGGAACTGGGGG + Intronic
1012295719 6:97520124-97520146 GAGAGTGGTTGGGGAGCTGTTGG + Intergenic
1013866142 6:114698456-114698478 GAGAGTGGCCAGAATGCAGAAGG + Intergenic
1014145172 6:117989146-117989168 GGGAGTGGACAGGGAGTGGAGGG - Intronic
1014271426 6:119340710-119340732 GAGAGAGGGCATGGAGATGAGGG - Intronic
1014514183 6:122361450-122361472 GACAGTGGTCAGAGAGCCGAGGG - Intergenic
1015663753 6:135603960-135603982 GAGAGATGACAGGGAGATGATGG + Intergenic
1015684740 6:135847290-135847312 GAGAGGGGACGGGGAGGTGATGG - Intergenic
1015854741 6:137611431-137611453 GGGCATGGCCAGTGAGCTGATGG - Intergenic
1016413091 6:143804228-143804250 GAGAGAGGCCAAGGAGCAAAAGG - Intronic
1017648706 6:156562331-156562353 CAGAGTGGCCACGGTGCTGTCGG + Intergenic
1017723210 6:157258762-157258784 GAGAGTTTCCAGGGGGTTGAGGG + Intergenic
1017780790 6:157713740-157713762 GAAGGTGGGCAGGCAGCTGACGG + Intronic
1017875398 6:158520084-158520106 GAGAGTGGCCTGGGGGAAGAGGG - Intergenic
1017884569 6:158588323-158588345 GGGAGTGTGCAGGGGGCTGAAGG - Intronic
1017906558 6:158760754-158760776 GACAATGTCCAGGGAGCTGGAGG - Intronic
1018202675 6:161410187-161410209 GTGGGTGGCCAGGAATCTGAAGG + Intronic
1018379612 6:163246332-163246354 GAGAGTGTCCAGGCAGAAGAAGG - Intronic
1018751729 6:166812421-166812443 GAGAGAGGCAAGGGGGCTGTGGG - Intronic
1018757443 6:166862570-166862592 GAGCGTGGCCAGGGAAGGGAGGG - Intronic
1018808223 6:167277558-167277580 GAGAGTGGACGGGCAGCTGCTGG + Intronic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1020334791 7:7054669-7054691 GAGAGTGGCCTGGGAGCCAATGG + Intergenic
1022011439 7:26311053-26311075 GGGGGTGGCCAGGGAACCGAAGG + Intronic
1022107533 7:27207684-27207706 GACAGTGGGCAGAGAGCTCATGG - Intergenic
1022502036 7:30887756-30887778 GAGCCTGGCCTGGGTGCTGACGG + Intronic
1022537337 7:31106375-31106397 GGGAGTGGGGAGGGTGCTGAGGG + Intronic
1023130714 7:37000244-37000266 CATAGTGGCCAGGGAGCTTTCGG + Intronic
1023218577 7:37893896-37893918 TAGAGTGGTCTGGGAGCTAAAGG - Intronic
1023286804 7:38629781-38629803 GAAAGTAGCCAGGGATCTGCTGG - Intronic
1023830482 7:44036424-44036446 GGGAGTGGCCTGGGTGCTGTGGG - Intergenic
1023830509 7:44036524-44036546 GGGAGTGGCCTGGGTGCTGTGGG - Intergenic
1024045469 7:45582668-45582690 AAGAGGGCACAGGGAGCTGAAGG - Intronic
1024342899 7:48285212-48285234 GAGAGGGTCCATGGGGCTGAAGG + Intronic
1024354769 7:48403238-48403260 GACAGTGGCCAGGGAGTGAAGGG + Intronic
1026867174 7:73830995-73831017 GAGAGTGCCCTGGCAGCTGTCGG + Exonic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1027682030 7:81233366-81233388 GAGGGAGGCCAGGGGGCTGAGGG - Intergenic
1028656465 7:93213748-93213770 GAGAGTGCCTAGGATGCTGAAGG + Intronic
1028908213 7:96178250-96178272 CAGAGTGGCCAGGGTGCCAAAGG + Intronic
1029139516 7:98400476-98400498 GAGAGTGAACGGGGAGCGGAGGG + Intronic
1029217966 7:98965480-98965502 GAGAGGGATGAGGGAGCTGACGG - Intronic
1029226775 7:99034196-99034218 CAGAGTGGCCAGGGCCCTGCAGG - Intronic
1029424225 7:100486451-100486473 GAGAGGGGCCAAGGAGCTGTGGG + Intronic
1029539173 7:101172900-101172922 TGGAGTAGCCAGGGAACTGAGGG + Intronic
1029740831 7:102490818-102490840 GGGAGTGGCCTGGGTGCTGTGGG - Intronic
1029758798 7:102589891-102589913 GGGAGTGGCCTGGGTGCTGTGGG - Intronic
1029758825 7:102589991-102590013 GGGAGTGGCCTGGGTGCTGTGGG - Intronic
1030061068 7:105621752-105621774 GAGAGAGGCCAGGGAGCTGCTGG - Intronic
1030724719 7:112913326-112913348 CAGAGGAGCCAGGGAGGTGATGG - Intronic
1031343472 7:120634841-120634863 GAGAATGGCCTGTGAGGTGAGGG - Intronic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1033289538 7:140071628-140071650 AAGGGTGGCCAGGGAACTGCCGG - Intergenic
1033415927 7:141161260-141161282 GAGAGTGGCCAGGGCTATGGTGG + Intronic
1033930014 7:146509029-146509051 GACAGTGGCCAGGGAGCCAAAGG + Intronic
1034215046 7:149398683-149398705 GACACTGGCCAGGGAGCTCAAGG + Intergenic
1034369920 7:150585973-150585995 TAGAATGACCAGGGAGCAGAAGG - Intergenic
1034412030 7:150946898-150946920 GAGGGTGGGGAGGGGGCTGACGG + Exonic
1036645358 8:10608915-10608937 AGGACTGTCCAGGGAGCTGAGGG - Exonic
1037311148 8:17558073-17558095 GATAGTTGCCAGAGAGCTGAGGG + Intronic
1039175515 8:34799653-34799675 GACAGAGGTCAGGGGGCTGAAGG + Intergenic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1041727611 8:61032508-61032530 GGTGCTGGCCAGGGAGCTGATGG + Intergenic
1042061655 8:64824545-64824567 GAGACTGGTCAGGGAGAGGAGGG - Intergenic
1042194191 8:66218372-66218394 GAGAATGCCCATGGAACTGAGGG - Intergenic
1042823567 8:72957589-72957611 GAGACTGGCAAGTGAGCTGGTGG - Intergenic
1042845873 8:73169190-73169212 GACGGTGGCCAGGGAGGGGATGG - Intergenic
1043989972 8:86740606-86740628 GAGAGTAGGCAGGGACCAGAAGG + Intronic
1047127474 8:121978017-121978039 GAGAGTGGGCAGGGCTCTGTTGG - Intergenic
1048187022 8:132250736-132250758 CAGAGTGCCCAGTGAGCTGGGGG - Intronic
1048871641 8:138804032-138804054 TAGAGGGGCCCAGGAGCTGAGGG - Intronic
1049251135 8:141589593-141589615 TAGAGTGGTCAGGGAGCTAGAGG + Intergenic
1049255865 8:141613474-141613496 GAGAGTGGGCTGGGAGGAGAAGG + Intergenic
1049439543 8:142602846-142602868 GAGAGTGGGAAGGGGGCAGAGGG + Intergenic
1049708661 8:144054051-144054073 GAGAGTGGCCTGGAGGCTGGGGG - Intronic
1049761742 8:144334743-144334765 GTGGGTGGCCGGAGAGCTGAGGG - Intronic
1049783448 8:144439388-144439410 CTGAGTGGCCAGGCAGCTGTGGG - Intronic
1049813204 8:144585504-144585526 GAGAGTTGCCCTGGAGCTAAGGG - Intronic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1052839248 9:33277447-33277469 GAGAGAGGCATGGGACCTGAAGG + Intronic
1053124107 9:35565540-35565562 GAGAAAGGCCAGGGTCCTGAGGG + Intergenic
1053299980 9:36942061-36942083 CAGTGTGCCCAGGCAGCTGATGG + Intronic
1053316781 9:37058813-37058835 GAGGCAGACCAGGGAGCTGAAGG - Intergenic
1053654153 9:40198040-40198062 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1053904542 9:42827216-42827238 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054366267 9:64344256-64344278 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054530442 9:66178299-66178321 GAGGGTGGCCAGGGAGAAGGGGG - Intergenic
1054673898 9:67833986-67834008 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054790698 9:69253916-69253938 GAGACTAGCCAGGGAGCTTAGGG + Intronic
1054979313 9:71185768-71185790 CAGAGTGGCCATTGAGCTCAAGG - Intronic
1057379702 9:94556270-94556292 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1057548260 9:96034052-96034074 GAGAATGGCCAGGTTTCTGATGG - Intergenic
1058781161 9:108336946-108336968 GAAAGTGGCAAGGGAGTGGAGGG + Intergenic
1059338569 9:113584170-113584192 GAGACGGGCCAGGGGGCTGAGGG + Exonic
1059692346 9:116698123-116698145 TACAGTGGCCAGGAGGCTGATGG - Exonic
1059962223 9:119576657-119576679 GAGAAGGGCCTGGGAGCTGGTGG + Intergenic
1060235770 9:121861668-121861690 TGGAGTGTCCAGGCAGCTGACGG + Intronic
1061299858 9:129698157-129698179 GAGGGGGCCCAGAGAGCTGAAGG - Intronic
1062125115 9:134856018-134856040 GAGAGTAGGCAGGGAGCGGGGGG + Intergenic
1062185435 9:135215861-135215883 GGGAGTGGCCAGAGAGGAGAGGG + Intergenic
1062285988 9:135772716-135772738 GACAGTGGCCATGGACCTGCAGG + Exonic
1062394609 9:136347795-136347817 GAGAGTGCTCAGGGAGCGGCTGG + Intronic
1062586292 9:137251434-137251456 GGGAGTGGCCAGGGGGCTGAGGG + Intronic
1062644939 9:137543081-137543103 GAGCTGGGCCAGGGAGCGGAAGG + Intronic
1186293331 X:8122403-8122425 CAGCGTGGAAAGGGAGCTGAGGG - Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1186892709 X:13975163-13975185 GAGAATGGCTAGGGAGCTCTGGG + Intergenic
1187182765 X:16958639-16958661 GAGAGGGGCCAGTGGGATGAGGG + Intronic
1187462508 X:19500561-19500583 GAGAGTGGTTGGGGAGCAGAAGG - Intronic
1187821342 X:23291318-23291340 GAGAGTGACCAGGAAGCATATGG - Intergenic
1191054375 X:56227228-56227250 GAGAGGCGCCAGGGCTCTGAAGG - Intergenic
1191675638 X:63789490-63789512 GAGAGAGGCGTGGGAACTGAGGG + Intergenic
1192151434 X:68715124-68715146 GAGGGTGCCCAGGGAGTTCAGGG - Intronic
1193508628 X:82372580-82372602 GACAGCGGCCAGGGAGCCGAAGG + Intergenic
1194240109 X:91435083-91435105 GAGACTGGCCAGGCAGCCGGCGG + Intronic
1196188602 X:112771610-112771632 CAGAGAGGCCAAGGAGCTGATGG + Intergenic
1197035564 X:121870093-121870115 GAGAGAGGCCAGGCAGCAGGAGG - Intergenic
1197100778 X:122651963-122651985 CTCAGTGGCAAGGGAGCTGATGG - Intergenic
1197752669 X:129976247-129976269 GAGAGTGGTCAGCAAGCTGAAGG + Intergenic
1199813203 X:151371211-151371233 GTGAGTCGCCTGGGAGCCGATGG - Intergenic
1200096713 X:153667985-153668007 GAGGCTGCCCAGGGTGCTGAAGG + Intergenic
1200110394 X:153737941-153737963 GCGAGTGGGCAGGCAGCTGAGGG + Intronic
1200115160 X:153766775-153766797 GACAGAGGCCAGGGTGCTCAGGG - Intronic
1200142253 X:153908078-153908100 GAGAGTGACCTGGAGGCTGAGGG - Intronic
1200225947 X:154417654-154417676 GAGTGGGGCTAGGGAGGTGAGGG - Intronic