ID: 1100398511

View in Genome Browser
Species Human (GRCh38)
Location 12:94206004-94206026
Sequence CACAACAACCTCACTCTTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100398511_1100398512 11 Left 1100398511 12:94206004-94206026 CCGTAAAGAGTGAGGTTGTTGTG 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1100398512 12:94206038-94206060 CAAACACTCCCATCAGTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100398511 Original CRISPR CACAACAACCTCACTCTTTA CGG (reversed) Intronic
901157467 1:7150141-7150163 CACACCTGCCTCACTCCTTACGG - Intronic
904954401 1:34270992-34271014 CACACCAACCACACTCCTTGAGG - Intergenic
906507589 1:46391757-46391779 CAGAACAGCCTCATACTTTAAGG + Intergenic
906973299 1:50542108-50542130 CACAACCAGCTGACACTTTATGG + Intronic
908029881 1:59987829-59987851 CCCAAAAACCTCAGGCTTTAAGG - Intronic
912684334 1:111750101-111750123 CACCACTGCCTCAGTCTTTAGGG - Intronic
914330426 1:146664596-146664618 AACAACATCCTCACTTTTGATGG - Intergenic
914732021 1:150379875-150379897 CACAAAAACATAACTCTTTGAGG + Intronic
916239642 1:162626045-162626067 CACTAAAACATCTCTCTTTAGGG - Intergenic
916455431 1:164966189-164966211 CACTACAACCTCCATCTTTTGGG - Intergenic
916949195 1:169761664-169761686 CACTACAACCTCCATCTTTCAGG + Intronic
920055441 1:203187422-203187444 CAAAAGATCCTCTCTCTTTATGG - Intergenic
920167681 1:204047063-204047085 CACTACAACCTCTCCCTTCAGGG - Intergenic
920242009 1:204559559-204559581 CACCACAGCCTCAGCCTTTAAGG + Intergenic
921088937 1:211824318-211824340 CACGACAACCTCTCTCTCTCAGG - Intronic
922440347 1:225651241-225651263 CACATTAAACTCACTCTTTAAGG + Intronic
923476708 1:234340466-234340488 CTCAACATCCTCAGTCATTAGGG + Intergenic
1064216836 10:13407550-13407572 AACAACAACCTGCCTATTTATGG + Intergenic
1064668824 10:17687170-17687192 CAAAATAACATAACTCTTTATGG - Intronic
1066315327 10:34240664-34240686 CAAAACAAGCCCTCTCTTTATGG - Intronic
1069999266 10:72364272-72364294 CCCAACAGTGTCACTCTTTATGG + Intergenic
1070196386 10:74160945-74160967 CCCGACAACCTCAGTCTTCAAGG + Intronic
1070355162 10:75632741-75632763 AAAACTAACCTCACTCTTTAGGG - Intronic
1071053857 10:81485858-81485880 CACAGTAAATTCACTCTTTATGG + Intergenic
1073529110 10:104215432-104215454 CACATCAACCACACTCTTGCTGG + Intronic
1076991028 11:274334-274356 TACAACAGCCTCAATCTCTAGGG + Intergenic
1083258403 11:61510227-61510249 CCCAACACCCTCCCTCTTTCTGG + Exonic
1086545723 11:87965528-87965550 CTCAACTCCTTCACTCTTTAGGG + Intergenic
1088695854 11:112365398-112365420 CACAACCAGCTCTCTCTTCAGGG - Intergenic
1089562720 11:119352964-119352986 AACAAGAACCTCCCTCTTTCTGG - Intergenic
1089960040 11:122608559-122608581 CACAATAACATCACACTTTATGG + Intergenic
1095613951 12:44166550-44166572 CACATCAAGTTCAGTCTTTATGG + Intronic
1097074666 12:56383981-56384003 CACCTCACCCTCACTCTTAAAGG + Intergenic
1098456018 12:70674007-70674029 CACCACAACCTCAATCTTCTGGG + Intronic
1099401673 12:82209374-82209396 CAGCACAACCTCATTCTTTTTGG + Intergenic
1099490252 12:83280323-83280345 CACAATGAACTCACTTTTTAGGG - Intergenic
1099967942 12:89470599-89470621 CACAACAACAAAACTCTATATGG + Intronic
1100398511 12:94206004-94206026 CACAACAACCTCACTCTTTACGG - Intronic
1102184375 12:110936306-110936328 GACAAAAACCTCAGCCTTTATGG - Intergenic
1105060174 12:133142599-133142621 CTCAACATCATCACTCGTTAGGG + Intronic
1106545561 13:30727938-30727960 AACAGCAACCTCACTGTTAAGGG + Intronic
1111794710 13:92903993-92904015 AACATCATCATCACTCTTTAGGG - Intergenic
1112729995 13:102350291-102350313 CACAACAACCTCAAACTCTTGGG - Intronic
1114236280 14:20826901-20826923 CAGAATAGCCTCACACTTTAAGG + Intergenic
1115439730 14:33419406-33419428 CACAACAATCACAGTTTTTATGG - Intronic
1117865177 14:60140661-60140683 CACACCAACCTCACTTTTTCAGG - Exonic
1122650989 14:103227006-103227028 CTGAACAACCTCCCTCATTAGGG - Intergenic
1124447058 15:29745643-29745665 CAACACAAACACACTCTTTAAGG + Intronic
1124689686 15:31811705-31811727 CTCACCATCCTCACTCTGTAGGG + Intronic
1126012839 15:44319661-44319683 CACTGCAACCTCAACCTTTAGGG + Intronic
1126263410 15:46722672-46722694 CACAATAACCACAATCTTTAGGG - Intergenic
1127870034 15:63064568-63064590 CTCAATAACCTGACACTTTAAGG - Intronic
1128309431 15:66621344-66621366 CCCAAGGACTTCACTCTTTATGG - Intronic
1130917513 15:88317613-88317635 CTCAACAACCTTTCTCCTTATGG - Intergenic
1131099597 15:89677658-89677680 CACAATAGCCCCACTCCTTAGGG + Intronic
1132406917 15:101547966-101547988 CACATCACCCTCACTTTTGAAGG - Intergenic
1134781647 16:16903569-16903591 CACTGCAACCTCAATCTTTAGGG + Intergenic
1135524864 16:23206452-23206474 CCCAGCAAGCTCATTCTTTAAGG - Intronic
1139720674 16:68850488-68850510 CACTACAAACCCACTGTTTAAGG + Intronic
1140003132 16:71046310-71046332 AACAACATCCTCACTTTTGATGG + Intronic
1145176404 17:20704135-20704157 TTCAACATCATCACTCTTTAAGG - Intergenic
1146355500 17:32130615-32130637 TTCAACATCATCACTCTTTAAGG + Intergenic
1148844229 17:50519363-50519385 CTCTTCAACCTCTCTCTTTAGGG - Intronic
1149161827 17:53703001-53703023 TACAACAACCCCACTTTGTATGG - Intergenic
1149704987 17:58686947-58686969 CACAGCAACCTCCATCTTTGGGG + Intronic
1153300952 18:3591625-3591647 CACTGCAACCTCAATCTTTTGGG - Intronic
1155897111 18:31343374-31343396 CAAAACAACCTGATTTTTTATGG - Intronic
1157303920 18:46502696-46502718 CACAGCATCCTCAGTCTTTCTGG + Intronic
1160047357 18:75399492-75399514 CACCACAGCATCACTCTTCATGG + Intergenic
1161304403 19:3558772-3558794 CACTACAGCCTCAATCTTCAGGG + Intronic
1162479674 19:10921106-10921128 CACAACAACCTGATTCCTTTAGG + Exonic
1167133603 19:47603534-47603556 CACTGCAACCTCCCTCTTTTGGG + Intergenic
925171151 2:1750900-1750922 CACCAAAACCTCATTCTTTCAGG - Intergenic
928091957 2:28380170-28380192 CAAAACTTCCTCACTCTTTGGGG + Intergenic
930466651 2:51760249-51760271 CATAACATCCTCACTCTTTGGGG - Intergenic
930765317 2:55079224-55079246 CAAACCAATCTCAGTCTTTATGG + Intronic
930779723 2:55212199-55212221 CACAGCAACCTCCCTCTCCAGGG - Intronic
933477508 2:82810328-82810350 CACAATAACATCACACTTTGGGG - Intergenic
937105887 2:119312321-119312343 CACTACAACCTCAGTCTCCAAGG + Intronic
939301231 2:140342173-140342195 TACAACAACTTCATTCTTTAAGG + Intronic
940273925 2:151919538-151919560 CACTCCTACCTCACTCTTAAGGG + Intronic
942471127 2:176261661-176261683 CACAGCTACCACACTCTTCAGGG - Intergenic
942591938 2:177555494-177555516 CACCACAACCTCAAACTTTTGGG - Intergenic
944851475 2:203724031-203724053 CACCAGAACTTCACTCTTCATGG - Intronic
948875653 2:240826250-240826272 GAAAACAACCACACCCTTTAGGG + Intergenic
1168749591 20:273048-273070 CACTACAACCTCTGTCTCTAGGG + Intronic
1170634692 20:18093937-18093959 CACTACAACCTCAGCCTCTAGGG - Intergenic
1171324564 20:24279987-24280009 CACAGAAAGCTCACTATTTAGGG + Intergenic
1172463581 20:35138158-35138180 AACAAAAACCTCACTCTGTTGGG + Intronic
1175291678 20:57880141-57880163 CACAAAAACCTCTCTCTTTGGGG + Intergenic
1177232529 21:18341135-18341157 CACAACAGCCTCAATCTCTCAGG + Intronic
1180893080 22:19305340-19305362 CACTACAACCTCCATCTTTGAGG - Intergenic
1183047583 22:35232485-35232507 AACTCCCACCTCACTCTTTAGGG - Intergenic
949608936 3:5684036-5684058 CAGAACCACCTCACTCCTCAGGG - Intergenic
951018019 3:17750751-17750773 CACAACAACCTAACAAGTTAGGG - Intronic
951081287 3:18453191-18453213 GACAAAAATCTCTCTCTTTATGG - Intergenic
953222819 3:40988787-40988809 CTCAGCAACCTCACATTTTATGG + Intergenic
957365194 3:79213464-79213486 AACAACAACATCAGTCATTAGGG - Intronic
963540127 3:146575870-146575892 CAGAATAACCTCGCTCATTAAGG + Intergenic
964249440 3:154694321-154694343 CACAGCTTCCTCACTCTTAACGG - Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967905885 3:194499652-194499674 CTCAACACCCACACTGTTTAAGG - Intergenic
969825412 4:9754033-9754055 CACAAAAACCTCACGCAGTATGG - Intergenic
971045520 4:22801333-22801355 CTTAACAGCATCACTCTTTAAGG + Intergenic
974360658 4:60874376-60874398 CACAATAACATCATACTTTATGG + Intergenic
974617831 4:64312688-64312710 CACTGCAGCCTCACTCTTCAGGG - Intronic
977713947 4:100159836-100159858 GACAACAACCTCACCTTCTAAGG - Intergenic
979905442 4:126284343-126284365 CAAAACAACCTCAGTCTTAGGGG + Intergenic
980973280 4:139586757-139586779 AAAAACAAACTCACTCTTTCAGG - Intronic
982209917 4:153026010-153026032 CCCAACAATCTCTCTCTTTCTGG - Intergenic
982661613 4:158214110-158214132 CACAGCAACCTCCACCTTTAGGG + Intronic
982889697 4:160832211-160832233 AACTACAAGCTCACTTTTTAAGG + Intergenic
983251768 4:165353827-165353849 CTCAACATCATTACTCTTTAGGG + Intergenic
983615849 4:169703971-169703993 AACAACAACAGAACTCTTTATGG - Intronic
984848462 4:184129528-184129550 CACAACAACCTTAGTCTCAATGG - Intronic
991109514 5:62882440-62882462 CATAACAGCCTCACTCTCTGGGG + Intergenic
994875011 5:105410688-105410710 CACCACAACCTCAGCCTTTTGGG + Intergenic
995597742 5:113765592-113765614 CACAAGCACCTCACTCCTTCTGG - Intergenic
996208407 5:120773325-120773347 CAAAACAAACTCAGTCCTTATGG - Intergenic
996262134 5:121485325-121485347 TACAACAACGTGACTCTTTGGGG - Intergenic
1001978066 5:176016996-176017018 CACAACGACCTAATTATTTAAGG + Intronic
1002239353 5:177826766-177826788 CACAACGACCTAATTATTTAAGG - Intergenic
1004183611 6:13402579-13402601 CTCAACATCATCAGTCTTTAGGG + Intronic
1004560685 6:16747040-16747062 CACACCATACTCACTCTGTAGGG + Intronic
1006233586 6:32607267-32607289 CACAACAACCTCTGCCTTTCAGG - Intergenic
1008218547 6:48825581-48825603 CAAAACACACTTACTCTTTAAGG - Intergenic
1008427072 6:51371139-51371161 CAATACAACCTCTATCTTTATGG - Intergenic
1009620693 6:66072211-66072233 CACAACAACCTCAGTCATGAGGG - Intergenic
1011569326 6:88717213-88717235 AACAATAACCTCAGTCTTTTAGG - Intronic
1012057667 6:94434366-94434388 CACAACAACCTCAAACTCCAAGG - Intergenic
1017666262 6:156722666-156722688 GCCAATAAGCTCACTCTTTAGGG - Intergenic
1017729177 6:157299980-157300002 CTCAACAAGCTCACTCTTCACGG + Intronic
1018624914 6:165768022-165768044 CTCAACATCATCAGTCTTTACGG - Intronic
1019777310 7:2919479-2919501 CACAACATCGTCACACTTCAGGG + Exonic
1020283062 7:6660621-6660643 CACTACAACCTCCCTCTTCCAGG - Intergenic
1020428293 7:8094250-8094272 CCCAACATCCTCACACTGTAAGG + Intronic
1026344254 7:69460733-69460755 CACAACCATCTCTCTCTTGAAGG + Intergenic
1032227101 7:130041261-130041283 CACTACAACCTCACCCTCTCAGG + Intronic
1032364555 7:131287024-131287046 CACTGCAGCCTCAATCTTTAGGG - Intronic
1033683443 7:143619065-143619087 TACATCAACCTCACTCCTCATGG - Intergenic
1033701170 7:143838573-143838595 TACATCAACCTCACTCCTCATGG + Intergenic
1033873629 7:145787496-145787518 CACTGCAACCTCCGTCTTTAGGG + Intergenic
1035923603 8:3704647-3704669 CACTCCAACCTCACCCTTTGTGG + Intronic
1037527721 8:19743067-19743089 CACAATAAACTCTCACTTTAGGG + Intronic
1040723537 8:50353752-50353774 CACAAAACCCACACTCATTATGG + Intronic
1044199175 8:89413647-89413669 CAGCATAACCTCATTCTTTATGG - Intergenic
1045460166 8:102418502-102418524 CACAGCAACCTCAATCTCCAGGG - Intergenic
1046227949 8:111310215-111310237 CACTACATCATCATTCTTTAGGG + Intergenic
1046829782 8:118731745-118731767 CACAACAGCCTCTCTCTCAAAGG + Intergenic
1047382789 8:124379245-124379267 AACAACTACCTGACTCTTCAAGG + Intergenic
1050461768 9:5883539-5883561 CACTACAACCTCATTCTTGTGGG + Intronic
1053564176 9:39230671-39230693 TACAATAACCATACTCTTTAAGG - Intronic
1053829963 9:42068542-42068564 TACAATAACCATACTCTTTAAGG - Intronic
1054132972 9:61388363-61388385 TACAATAACCATACTCTTTAAGG + Intergenic
1054600593 9:67118911-67118933 TACAATAACCATACTCTTTAAGG + Intergenic
1055923441 9:81485956-81485978 CACTACAACCTCCATCTTTTGGG - Intergenic
1056333074 9:85537876-85537898 CACAACAACCTGACTTTCCAAGG + Intergenic
1057130285 9:92649948-92649970 CACCACAACCTCCGTCTCTAGGG - Intronic
1058947777 9:109875110-109875132 CACCCCAACCTCACTTATTATGG + Intronic
1059291186 9:113225501-113225523 CACAACAACCTCATGTTCTAGGG - Intronic
1059792368 9:117653986-117654008 AACAACAACAACACTCTTCAGGG - Intergenic
1060697353 9:125720771-125720793 CACTGCAACCTCAATCTTTCAGG - Intergenic
1061338046 9:129955643-129955665 AACAACAACCTCTGTCTTCAGGG - Intronic
1186966417 X:14791025-14791047 GCCAACAACCTCACTTTCTAAGG + Intergenic
1188313874 X:28650039-28650061 CACAACAACATAAGTTTTTAGGG - Intronic
1189076487 X:37920842-37920864 CACAAAAACCACAATGTTTAAGG + Intronic
1191086976 X:56579105-56579127 CACTACAACCTCCGTCTTCAGGG + Intergenic
1192821003 X:74645343-74645365 CACAACAACCTGCCTACTTAAGG - Intergenic
1193908506 X:87272658-87272680 CAAAACAACCTCCCTGTTAATGG + Intergenic
1196201944 X:112896544-112896566 CACAGCAACCTGCCTCCTTAAGG - Intergenic
1199319645 X:146423098-146423120 GACAACTAACTCCCTCTTTAGGG - Intergenic
1199460377 X:148077319-148077341 CACAACCACGTGACTCTTTTGGG + Intergenic
1200701943 Y:6409843-6409865 CACAACAACCTGCCTCATGAAGG - Intergenic
1201032168 Y:9754855-9754877 CACAACAACCTGCCTCATGAAGG + Intergenic
1201363355 Y:13177147-13177169 CACCACAACCTCTGTCTCTAAGG - Intergenic