ID: 1100399765

View in Genome Browser
Species Human (GRCh38)
Location 12:94218865-94218887
Sequence ATCTAACAATATTAGCAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100399764_1100399765 -8 Left 1100399764 12:94218850-94218872 CCTTCTTTAATCATTATCTAACA 0: 1
1: 0
2: 2
3: 27
4: 342
Right 1100399765 12:94218865-94218887 ATCTAACAATATTAGCAATAAGG 0: 1
1: 0
2: 1
3: 19
4: 264
1100399763_1100399765 -5 Left 1100399763 12:94218847-94218869 CCACCTTCTTTAATCATTATCTA 0: 1
1: 0
2: 2
3: 27
4: 299
Right 1100399765 12:94218865-94218887 ATCTAACAATATTAGCAATAAGG 0: 1
1: 0
2: 1
3: 19
4: 264
1100399761_1100399765 26 Left 1100399761 12:94218816-94218838 CCTTAACTAATTCTAAAGCACAT 0: 1
1: 0
2: 2
3: 17
4: 237
Right 1100399765 12:94218865-94218887 ATCTAACAATATTAGCAATAAGG 0: 1
1: 0
2: 1
3: 19
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100399765 Original CRISPR ATCTAACAATATTAGCAATA AGG Intronic
905712010 1:40113176-40113198 ATCTAACAAAAAAAGCAATGGGG + Intergenic
908932700 1:69336782-69336804 ATTTAATAATACTAGCAACATGG - Intergenic
909259017 1:73463402-73463424 ATCTAATAATATTAGCCTTTTGG - Intergenic
909723657 1:78808367-78808389 TTATAACAATATTAGCAAAATGG + Intergenic
909751632 1:79168329-79168351 ATCTTACTATATTAGTATTATGG + Intergenic
912402409 1:109406046-109406068 ATCAACCAAGATTAGAAATATGG + Intronic
913238252 1:116803836-116803858 ATGTAATAATAATAGAAATAAGG + Intergenic
914958172 1:152183457-152183479 GTCTAACAATCTTGGCACTAAGG + Intergenic
915006534 1:152643191-152643213 TTTTTACAATATCAGCAATAAGG + Intergenic
915819549 1:159007308-159007330 ACTTAACAATATTAGCACAAGGG - Intronic
916607829 1:166360381-166360403 ATCTAACAATGTAAGCAGCACGG - Intergenic
917577632 1:176340570-176340592 GATTAACAATAATAGCAATAAGG + Intergenic
917885372 1:179379249-179379271 AAATAACAATATTAGCAATGTGG - Intronic
918954939 1:191195250-191195272 AATTAACAATATTAACAATCAGG - Intergenic
919417318 1:197327465-197327487 ATGAAACAAAATTACCAATATGG + Intronic
919557988 1:199085189-199085211 ATAAAACAATATGTGCAATATGG + Intergenic
921426984 1:215014923-215014945 ATATAAGAATATTAGCTAAAGGG + Intronic
922114766 1:222602174-222602196 AACAATCAATACTAGCAATAGGG - Intergenic
922205958 1:223446747-223446769 ATCTACAAATATTAGTAATTGGG + Intergenic
922587129 1:226742297-226742319 ATGAAACAAAATTAGGAATAAGG + Intergenic
924066498 1:240228436-240228458 ATTCAACACTATTAGCATTAGGG + Intronic
924067422 1:240238787-240238809 ATCTATCAATATTAGATACACGG + Intronic
924175104 1:241383328-241383350 ATAAAATAATATTAACAATATGG + Intergenic
924667665 1:246090094-246090116 ATCTAGCATTATTAAGAATAAGG + Intronic
1063280024 10:4618129-4618151 TTTTAGCAGTATTAGCAATATGG - Intergenic
1063878762 10:10509336-10509358 ATGTAACAATATTAGGAAGTGGG + Intergenic
1064562950 10:16610706-16610728 ATGTAATAATAATAGAAATAAGG + Intronic
1064768650 10:18700801-18700823 ATTTAACAATATTAGTCATGTGG + Intergenic
1065956767 10:30700431-30700453 ATCTAACTATTATAGAAATATGG + Intergenic
1067171302 10:43908734-43908756 ATCCAAAAATATTAAAAATAAGG + Intergenic
1068293646 10:55037789-55037811 ATCTAATAGTTTTAGCATTAAGG + Intronic
1068842927 10:61636279-61636301 ATCTAGAAATATCACCAATAAGG + Intergenic
1071163045 10:82773811-82773833 AGCTAACATTATAATCAATAGGG - Intronic
1074515220 10:114161130-114161152 ACCTAAAAATATGAGGAATAGGG - Intronic
1075181051 10:120212086-120212108 ATCTAACTAAATCAGGAATAAGG - Intergenic
1075210160 10:120484201-120484223 CAATAACAATATTAGCAAAAGGG + Intronic
1075500822 10:122972115-122972137 ATGTAACAGTATTAGGAATGGGG + Intronic
1079722172 11:23830157-23830179 ATATAACATTATCAGCACTATGG + Intergenic
1080174631 11:29347292-29347314 ATTGAACAATATTAACTATAAGG + Intergenic
1081200681 11:40211490-40211512 ATCTAAAAATGTAAACAATAAGG + Intronic
1087487809 11:98780004-98780026 ATGTAACAGTACTAGCATTATGG + Intergenic
1087534244 11:99424152-99424174 ATAGAACAATTTTAACAATATGG + Intronic
1087902729 11:103660703-103660725 ATTTAAGAATATCAGGAATAAGG + Intergenic
1090380285 11:126321791-126321813 GTATAAGAATATTATCAATAAGG + Intronic
1090746693 11:129711017-129711039 ATCTACCAAGGTTATCAATAAGG + Intergenic
1091069338 11:132548559-132548581 AAATAACAATATTAGCACAATGG + Intronic
1091081481 11:132673066-132673088 ATCAATGCATATTAGCAATAAGG + Intronic
1092522218 12:9286896-9286918 ATCTACTAATATTAGTAAAATGG + Intergenic
1092545065 12:9444962-9444984 ATCTACTAATATTAGTAAAATGG - Intergenic
1092805376 12:12217436-12217458 ATGTAATAATAATAGAAATAAGG + Intronic
1093343490 12:18009279-18009301 ATCTCTGAATTTTAGCAATAAGG + Intergenic
1094255413 12:28419521-28419543 ATGTAGCAGTATTAGCAAAATGG + Intronic
1094507885 12:31077094-31077116 ATCTACTAATATTAGTAAAATGG + Intronic
1097393281 12:59041746-59041768 CAATAACAGTATTAGCAATAGGG - Intergenic
1097424148 12:59421176-59421198 ATCTAAAAATATTAGGGGTATGG - Intergenic
1098413265 12:70203856-70203878 ATATGACAATAATAGCACTAAGG + Intergenic
1098619441 12:72575707-72575729 TTCTATCAATAATAGCTATAGGG + Intronic
1099245193 12:80185905-80185927 ATATAAAAATATTAGAAAAAAGG + Intergenic
1099899444 12:88689919-88689941 ATATTCCAAGATTAGCAATAAGG - Intergenic
1099970599 12:89496059-89496081 ATGTAATAATAATAGAAATAGGG - Intronic
1100369276 12:93951339-93951361 ATCTGACAATAACAGCAAAAAGG + Intergenic
1100399765 12:94218865-94218887 ATCTAACAATATTAGCAATAAGG + Intronic
1100640140 12:96474725-96474747 ATTTAAAAATATCATCAATATGG + Intergenic
1104248450 12:127065408-127065430 ATCTAACAAGGTTAGAAATGAGG + Intergenic
1105394417 13:20016001-20016023 ATTTAACATAATTACCAATAAGG + Intronic
1106974899 13:35198494-35198516 AGCTAAGAATATTAGCACTCAGG - Intronic
1107161563 13:37235282-37235304 ATATAACAATATTAGCACAAAGG + Intergenic
1107608348 13:42085488-42085510 TTCTCAAAATATGAGCAATAAGG + Intronic
1108830312 13:54469571-54469593 ATGGAAAAATATTAGCAAGATGG - Intergenic
1109376690 13:61504228-61504250 ATATAACGATATAAACAATATGG - Intergenic
1109510925 13:63372174-63372196 ATTTATCAAACTTAGCAATAAGG - Intergenic
1109694691 13:65938857-65938879 ATCGACAAATATTAACAATATGG - Intergenic
1113142015 13:107163784-107163806 ATCTAAGAAAAATAGAAATAAGG + Exonic
1117304961 14:54465036-54465058 ATTTCAGAATACTAGCAATAAGG + Intergenic
1117575008 14:57088870-57088892 ATGTAATAATAATAGAAATAAGG + Intergenic
1117680949 14:58202161-58202183 AGCTAACAATATTAGAATGATGG + Intronic
1118737107 14:68709487-68709509 ATCTTACAATATTAGTGTTAAGG - Intronic
1119020076 14:71102835-71102857 ATCATATTATATTAGCAATATGG - Intronic
1121216172 14:92249940-92249962 ATCTAACATCATTAGCTATTTGG - Intergenic
1123668908 15:22634221-22634243 ATATCACTATATTAACAATATGG - Intergenic
1124093373 15:26626599-26626621 TTCTATCAATATCAGCAGTAAGG - Intronic
1125439407 15:39685979-39686001 AGCTAAAAATATTAGCAAAAAGG + Intronic
1125532106 15:40420377-40420399 TTATAACAAAATTAGCCATAGGG - Intronic
1126176251 15:45738505-45738527 ATGTAACAATGTTATCAAAAAGG + Intergenic
1127168701 15:56275627-56275649 ATATAACAATAATAGCACAAAGG - Intronic
1127454682 15:59146018-59146040 CTCTAAAAATAATAACAATAAGG - Intronic
1127523404 15:59767025-59767047 ATGTAAAAGTATTAGTAATAAGG + Intergenic
1129915049 15:79261655-79261677 ATTTAACACTTTTAGGAATAAGG + Intergenic
1133631169 16:7623302-7623324 ATGTAATAATAATAGAAATAAGG - Intronic
1135599266 16:23768125-23768147 ATCCAACAATATGAACAAGAAGG + Intergenic
1140534343 16:75695722-75695744 ATCTAACAATGTTCTCAAAATGG + Intronic
1142526396 17:544774-544796 ATCTAAGAAAATAAGCAATATGG + Intronic
1142788455 17:2244160-2244182 ATCTAATGAGATCAGCAATATGG + Intronic
1144375861 17:14640608-14640630 ATTTAACATAATTAGCACTAAGG - Intergenic
1146158407 17:30544170-30544192 ATCCTCCATTATTAGCAATAAGG - Intergenic
1147695883 17:42352538-42352560 CTCTTACAATATTTGCATTAGGG + Intronic
1148174878 17:45555245-45555267 TTCTTACAATATCAGCAATAAGG + Intergenic
1148296493 17:46507782-46507804 TTCTTACAATATCAGCAATAAGG - Intergenic
1148519814 17:48262082-48262104 ATCTAAAAATATTAGTAGTGTGG + Intronic
1149879696 17:60276335-60276357 ATTTTAAAATTTTAGCAATAGGG + Intronic
1150406095 17:64902156-64902178 TTCTTACAATATCCGCAATAAGG + Intronic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1154175147 18:12082232-12082254 ATCTAACAATTTTAATAATTGGG - Intergenic
1155373318 18:25128283-25128305 CTCTGACAAAACTAGCAATAGGG + Intronic
1156443036 18:37210900-37210922 ATTGAACAAAATTAGCAATGAGG + Intronic
1157016172 18:43717688-43717710 AACTAACAATATTAGAAATAAGG + Intergenic
1159171438 18:64773802-64773824 ACGTAACAATAGTAACAATATGG + Intergenic
1159487800 18:69087771-69087793 AGCCAACAATATTAGTAATTAGG - Intergenic
1161100934 19:2421585-2421607 CTCTAAAAATAATAACAATAAGG - Intronic
1162897029 19:13770922-13770944 ATGAACCAATATTAGCATTATGG + Intronic
925697828 2:6600377-6600399 AACTAACATTATAATCAATAGGG + Intergenic
926944550 2:18172567-18172589 ATCTAAGAATTTTAGAAAAATGG + Intronic
927101581 2:19791514-19791536 ATGTAAGAATATTAACAACAGGG - Intergenic
931113704 2:59141464-59141486 AACCAAGAATCTTAGCAATATGG - Intergenic
932132743 2:69202350-69202372 ATCTAATAAGATTAGCAGTAAGG + Intronic
932443769 2:71757746-71757768 ATCTTACAAAAATATCAATAAGG - Intergenic
932686618 2:73876090-73876112 ATATAACAATAATAGTAATAAGG + Intergenic
933227814 2:79771422-79771444 ATGTAATAATAATAGAAATAAGG - Intronic
935096516 2:99949458-99949480 ATGTAATAATAATAGAAATAAGG - Intronic
935357269 2:102213929-102213951 ATATAAAAAAATTAGAAATATGG + Intronic
936552042 2:113452809-113452831 ATCAAACAATTTGAGCAGTATGG - Intronic
936755809 2:115710553-115710575 ATCAAACAATAATAGCATCATGG + Intronic
937498957 2:122456793-122456815 ATCTACAAAAATAAGCAATAGGG + Intergenic
937696565 2:124814930-124814952 AACCAACAGTATTAGCATTACGG - Intronic
939547490 2:143571220-143571242 ATGTAACAATAATAGAAATAAGG + Intronic
939685339 2:145191820-145191842 ATCTAACAACATGAGGAAAAAGG + Intergenic
939791695 2:146586555-146586577 CTCTAGCTATATTAGTAATAGGG - Intergenic
939950393 2:148465242-148465264 ATCAAACAATGTTATCAAAATGG - Intronic
940050874 2:149463284-149463306 ATTTAACATCATTAGCCATAAGG + Intronic
940222574 2:151368631-151368653 ATCTTAAAATATTAGGATTAGGG + Intronic
941459475 2:165751846-165751868 ATCTAAAAATTTTAGCACTCAGG + Intronic
941494473 2:166182655-166182677 ATGTAATAATAATAGAAATAAGG - Intergenic
941544335 2:166828635-166828657 ATCTAAATATATTAGAAATGAGG - Intergenic
942010114 2:171753383-171753405 ATCAAACATTATTAGAAATGAGG - Intergenic
942699208 2:178685416-178685438 ATTTATCAATATTTGCAATATGG + Intronic
943815045 2:192242677-192242699 AAATAACAATAGTAGCAAAAGGG + Intergenic
943859994 2:192849236-192849258 ATTTAACAATATTAACATGAAGG + Intergenic
944560591 2:200933072-200933094 ATCAGAGAATATAAGCAATATGG - Intronic
945262237 2:207854221-207854243 ATGTAAAAATTTTAGAAATAAGG - Intronic
945344203 2:208693591-208693613 ATCTTAGAATAATAGCAATGTGG - Intronic
945635678 2:212347068-212347090 ATCTTACAATGTTAGCACTTAGG - Intronic
946318482 2:218933160-218933182 AACTAATAAAATTAGCATTAAGG + Intergenic
946826546 2:223684881-223684903 ATATAATAATATAAGAAATAAGG + Intergenic
1170239705 20:14150555-14150577 ATATAAAAATATTAGGAAGAAGG + Intronic
1173173044 20:40742541-40742563 ACCTAGCAATATCCGCAATAAGG + Intergenic
1178269430 21:31176194-31176216 ATCTAGCAATATTAACAATCTGG - Intronic
1179431066 21:41321575-41321597 GTCTAACAATCTTAGCAGTTTGG + Intronic
1181087568 22:20448943-20448965 ATGTAACATTATTAGCTATCAGG - Intronic
1182177781 22:28310341-28310363 TACTAACAATTTTAACAATAGGG - Intronic
949395856 3:3614170-3614192 AGCTAACAATATCGGCAACAGGG + Intergenic
950999831 3:17544845-17544867 ATCTAAACATATTAGCAGTTTGG - Intronic
951505637 3:23441984-23442006 AACTAACAATATGAACACTAGGG - Intronic
951759779 3:26133867-26133889 ATGTAACAATAATAGCACAAAGG - Intergenic
952185872 3:30968289-30968311 ATGTAACCATATTAGGAAGATGG + Intergenic
952632995 3:35492454-35492476 ACCTCACAATTTCAGCAATAGGG + Intergenic
956069669 3:65434543-65434565 ATCTAACCAAATTAGCTATATGG + Intronic
956438647 3:69259030-69259052 ATGTAAAAATAATAGAAATAAGG - Intronic
956594625 3:70952430-70952452 TTCCAGAAATATTAGCAATATGG - Intergenic
957739861 3:84250450-84250472 ACCTAACAAAATAAGCAATAGGG - Intergenic
959201214 3:103250208-103250230 ACCTAATATTATTAGCAAGATGG - Intergenic
959241202 3:103796957-103796979 ATAGAACAATAGTAGAAATAAGG - Intergenic
962130234 3:132665063-132665085 ATCTAACAATATTGGGAAGTTGG + Intronic
962884287 3:139609476-139609498 ATTTAACAACATTAACAATTAGG - Intronic
963154580 3:142082340-142082362 ATGTAATAATATTAGAAATAAGG + Intronic
963472873 3:145764752-145764774 ATCTAACAGTATAAACAAAATGG - Intergenic
964207551 3:154191052-154191074 ACATAACAGTATTAACAATAAGG - Intronic
965238822 3:166165356-166165378 ATGTAACAATAATATTAATATGG + Intergenic
965575374 3:170212877-170212899 TTACAAAAATATTAGCAATATGG + Intergenic
965859884 3:173136058-173136080 GTCTAAGAATATAAGCAAGAAGG + Intronic
966603846 3:181802074-181802096 ATCAACCAATTTTAGCAATGAGG - Intergenic
968025659 3:195440890-195440912 AGCTAACAATAATTGGAATATGG + Intronic
968993879 4:3933261-3933283 ATCTAACATGAGTAGCAAAATGG + Intergenic
971822899 4:31581815-31581837 ATCTTAAAATAATATCAATATGG - Intergenic
971874015 4:32280949-32280971 ATCTATCAAAATTAGTAGTAGGG - Intergenic
972208609 4:36809539-36809561 ATTTAACAATAATAATAATAAGG - Intergenic
972747134 4:41946346-41946368 ATATAACTATATGATCAATAAGG - Intronic
976380814 4:84396253-84396275 ATCTGACAATATTAATTATATGG + Intergenic
976773297 4:88678737-88678759 TCATAACAAGATTAGCAATAGGG - Intronic
977850881 4:101827112-101827134 TTATAAAAATATAAGCAATATGG + Intronic
978182972 4:105823856-105823878 ACGTAAAACTATTAGCAATAGGG - Intronic
978319688 4:107479768-107479790 ACCTGAAAACATTAGCAATATGG + Intergenic
978998136 4:115180066-115180088 ATATTAAAATATTAGCAAGATGG + Intergenic
980250908 4:130313332-130313354 ATATAATAATAATAGAAATAAGG + Intergenic
980261963 4:130460968-130460990 ATTTAACATTATTAGCCATTTGG + Intergenic
982086295 4:151840143-151840165 ATGTAATAATAATAGAAATAAGG + Intergenic
983908363 4:173208094-173208116 ATTTAAGAATATTAACAATTTGG + Intronic
984052520 4:174883420-174883442 ATCTGATAATATGAGCAATTTGG - Intronic
984411183 4:179400184-179400206 ATCTTACAATATTAAGATTATGG - Intergenic
984512933 4:180700851-180700873 ATGTAAAAATATTATCAAAAAGG + Intergenic
988095552 5:26604610-26604632 ATGAAAAAATATTAGCAAAAAGG - Intergenic
988416985 5:30957844-30957866 TTCTGACAACATTAGCAATGAGG + Intergenic
990376868 5:55179242-55179264 ATCTAACTAGATTAGCCATATGG - Intergenic
990644998 5:57834146-57834168 ACATAACATTAATAGCAATATGG + Intergenic
991906634 5:71520305-71520327 ATCTTAAAATAAAAGCAATATGG - Intronic
993011055 5:82483492-82483514 ATTTAACAATATTAGTAAGATGG + Intergenic
993049100 5:82905101-82905123 TTCTAGCAATTTTATCAATAAGG + Intergenic
993251885 5:85537800-85537822 AACTAACAATATTAATAAAAAGG - Intergenic
993753427 5:91699242-91699264 GTCTATCAAAATAAGCAATAGGG - Intergenic
994254253 5:97574203-97574225 ATCTAAGAATATAAGTCATAAGG + Intergenic
994526089 5:100906021-100906043 ATCTAACAATATTAAACAAATGG - Intergenic
994982014 5:106887699-106887721 ATCTAAAAATAAGAGCAATTTGG + Intergenic
995245214 5:109927664-109927686 AGCTAACAGTAATAGTAATAGGG - Intergenic
998608987 5:143667106-143667128 AGCTAACAGGACTAGCAATAAGG + Intergenic
998674271 5:144389591-144389613 ATGTAATAATAATAGAAATAAGG + Intronic
1000768960 5:165326945-165326967 ATAAAACAATATTTGAAATAGGG + Intergenic
1002119421 5:176990644-176990666 ATCTATTTATATTAGAAATATGG - Intronic
1003213083 6:4085116-4085138 ATCCAAGAATATTAGCACCATGG + Intronic
1004082712 6:12411076-12411098 GACTAACAATATTAGGAGTAAGG + Intergenic
1004478495 6:15996987-15997009 ATTTAGCTATATTAGCAAAATGG + Intergenic
1006875692 6:37293843-37293865 TTCTATCCATATCAGCAATAAGG - Intronic
1008908095 6:56702341-56702363 ATTGAACACTATTAGCAAGAGGG + Intronic
1009380626 6:63024425-63024447 ATATAACACAATTAGCAATGGGG - Intergenic
1009606492 6:65875770-65875792 TCCTAACATCATTAGCAATAAGG + Intergenic
1009696521 6:67112127-67112149 ATTTAAAAATATTAGCAAGTGGG - Intergenic
1009715372 6:67386210-67386232 ATTTAACAATATTAGATATAGGG - Intergenic
1010566064 6:77415623-77415645 CTTTATCCATATTAGCAATAAGG + Intergenic
1012396686 6:98806174-98806196 ATCTAAGAATAATAGAAAAAAGG - Intergenic
1012552443 6:100476261-100476283 ATCTAACACTATTTGCCATTAGG - Intergenic
1012610362 6:101211132-101211154 ATAAAACAGTATTAGGAATATGG - Intergenic
1013934219 6:115573360-115573382 ATCTGAAAAAATTAGCAATCCGG - Intergenic
1014577189 6:123088040-123088062 ATCTAATAAAATTGGAAATATGG + Intergenic
1014808878 6:125863037-125863059 AACTAAAAATATTAAAAATATGG + Intronic
1016025925 6:139286936-139286958 ATGTAATAATAATAGAAATAAGG + Intronic
1016169435 6:140991911-140991933 ATTTATCAATACTAGAAATAAGG + Intergenic
1016724743 6:147349957-147349979 ATCCAAATATAATAGCAATATGG + Intronic
1017019407 6:150128238-150128260 ATTTAAAAATATTAACTATAAGG + Intergenic
1017321283 6:153096934-153096956 ATATAACAACATTGACAATAGGG + Intronic
1018654129 6:166016872-166016894 ATATGACAATATTAGCACAAAGG + Intergenic
1019375059 7:685889-685911 ATATATAAATATTATCAATATGG + Intronic
1021075965 7:16305140-16305162 ATCTTACAATGTTATCAAAAGGG + Intronic
1021122348 7:16810740-16810762 ATCTAACAATATTGACTCTAGGG - Intronic
1021279768 7:18703402-18703424 ATATATCAAAAGTAGCAATAAGG + Intronic
1022279909 7:28897323-28897345 ATATAACAATATTAAAATTAGGG - Intergenic
1022373633 7:29792582-29792604 ATATAAGAATTTTAGCACTATGG + Intergenic
1023174704 7:37424532-37424554 ATTTGTCAATATTAGCAATTGGG + Intronic
1029169793 7:98622367-98622389 AGCTAACAATATTACCCACACGG + Intronic
1029618420 7:101674567-101674589 ATATAAATATATTTGCAATAGGG - Intergenic
1030501185 7:110361904-110361926 ATCTAACAATGTCAACAAAATGG - Intergenic
1031823992 7:126540204-126540226 ACCTAACATTATTAGCTATCAGG + Intronic
1033906685 7:146213712-146213734 AGATATAAATATTAGCAATAAGG + Intronic
1034360201 7:150489441-150489463 ATCTAATATGATTATCAATATGG - Intergenic
1035712394 8:1728724-1728746 AACTCACAATATTAAAAATAAGG - Intergenic
1042992061 8:74652620-74652642 ATCTCACAATTTTAAAAATAGGG + Intronic
1043501094 8:80857294-80857316 CTCTACCAATATCAGGAATAAGG - Intronic
1043666569 8:82822291-82822313 GGCTATCAGTATTAGCAATATGG + Intergenic
1044031734 8:87246842-87246864 ATATAATAATAATAGAAATAAGG - Intronic
1044172734 8:89075779-89075801 ATGTAATAATAATAGAAATAAGG + Intergenic
1044415594 8:91935664-91935686 ATCTAAAAATTTTAGAGATAAGG - Intergenic
1046265835 8:111828628-111828650 ACCTAACTATATTAGCTGTAAGG - Intergenic
1046754304 8:117957238-117957260 TTCCAAAAATATCAGCAATAAGG - Intronic
1047655496 8:126972690-126972712 ATATTACAATATTAGGAATGGGG - Intergenic
1047911050 8:129529698-129529720 ATCTAACAACATAAGCCAAAGGG + Intergenic
1048458173 8:134597316-134597338 ATCTTACTATGTTGGCAATATGG + Intronic
1049900962 9:164345-164367 ATCAAACAATTTGAGCAGTATGG + Intronic
1052572459 9:30244019-30244041 ACCTATCAATATAAGAAATAGGG + Intergenic
1052601255 9:30635282-30635304 ATCTAACTATAGTACAAATACGG - Intergenic
1053743999 9:41174660-41174682 ATCAAACAATTTGAGCAGTATGG + Intronic
1054349277 9:64004463-64004485 ATCAAACAATTTGAGCAGTATGG + Intergenic
1054483274 9:65690637-65690659 ATCAAACAATTTGAGCAGTATGG - Intronic
1054684345 9:68256593-68256615 ATCAAACAATTTGAGCAGTATGG - Intronic
1055972409 9:81924710-81924732 ATCTAACTATTTTAACATTAGGG + Intergenic
1055974162 9:81939782-81939804 ATCTAACTATTTTAACATTAGGG + Intergenic
1056139880 9:83665542-83665564 ATATAACAATTTTACCAGTAAGG + Intronic
1058107788 9:100992702-100992724 ATCTAGCAAAATTAACAATAAGG - Intergenic
1058474167 9:105314062-105314084 TAATAACAATATTAGTAATAAGG - Intronic
1058489685 9:105483770-105483792 ATCTATCAACATCAGCTATAGGG - Intronic
1058657283 9:107234948-107234970 ATTTCACAATATTTGAAATAGGG - Intergenic
1059258758 9:112955613-112955635 CTCAAAAAATATTATCAATAGGG + Intergenic
1061779316 9:132986492-132986514 ATGTGACCTTATTAGCAATAGGG - Intronic
1187605996 X:20884209-20884231 TTTTAACAATATTAACCATATGG + Intergenic
1193084725 X:77438772-77438794 ATTTAAAAATATTGGAAATAGGG - Intergenic
1193485657 X:82083020-82083042 ATCAAACAAAATTAGGAGTATGG + Intergenic
1194344006 X:92739833-92739855 AAATAACAATATTACCAAGATGG - Intergenic
1194460059 X:94155009-94155031 AGATAAAAATATCAGCAATAGGG + Intergenic
1194904596 X:99558821-99558843 AGCTAGCAATATCAACAATATGG - Intergenic
1195014856 X:100768233-100768255 ATGTAACAATATATGCATTATGG - Intergenic
1195791714 X:108595422-108595444 TTCTAAAAATGTTAGCACTAAGG - Intronic
1195990917 X:110681325-110681347 ATCTAACACTATTGTCATTATGG - Intronic
1196309121 X:114140867-114140889 ATCTTACCAGATTAGCAATCAGG + Intergenic
1196971271 X:121111145-121111167 ATCCAACATTATTAGCCATTAGG - Intergenic
1197400492 X:125983474-125983496 ATCAAAAAATATTAACAATTTGG + Intergenic
1197683883 X:129417445-129417467 ATTTACCCATATTAGAAATATGG - Intergenic
1198375086 X:136031004-136031026 AGCTAACAAAATTAGCATTTAGG - Intronic
1200652355 Y:5856489-5856511 AAATAACAATATTACCAAGATGG - Intergenic
1200809805 Y:7472389-7472411 ATGTAATAATAATAGAAATACGG + Intergenic