ID: 1100400085

View in Genome Browser
Species Human (GRCh38)
Location 12:94221778-94221800
Sequence TCTCACATACAGAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100400079_1100400085 12 Left 1100400079 12:94221743-94221765 CCTCTGACTTCGCAGATGGTGCC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 185
1100400080_1100400085 -9 Left 1100400080 12:94221764-94221786 CCTTGTTGCTGTATTCTCACATA 0: 1
1: 2
2: 49
3: 347
4: 1318
Right 1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100400085 Original CRISPR TCTCACATACAGAAGGGGCA GGG Intronic
902767724 1:18628429-18628451 TTTCACATCCAGCAGGGGAAAGG - Intergenic
902830648 1:19010227-19010249 TCTCACATCCAGAACAGGCAGGG - Intergenic
902874458 1:19332467-19332489 CCTCACAAAGAGAAGGGCCAAGG + Intergenic
904359375 1:29962061-29962083 GCTCACAGTCAGGAGGGGCATGG - Intergenic
905930718 1:41785240-41785262 TTTCTCATACAGAAGGGCCTTGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906200049 1:43954185-43954207 TGGCACAAAGAGAAGGGGCAGGG - Intronic
906894317 1:49754645-49754667 TCTCTCATTCAGAAGGTACAGGG + Intronic
907824488 1:58001916-58001938 TCACACATACAGAAAGGAAAAGG + Intronic
911697203 1:100903809-100903831 TCACACATACAGAAAAAGCATGG - Intronic
911711367 1:101077517-101077539 TCTCGCAAACAGATGGGTCATGG + Intergenic
912172639 1:107119050-107119072 TCTCCCATGGATAAGGGGCAGGG + Intergenic
912936799 1:114010781-114010803 TCCCACAAACCAAAGGGGCAAGG + Intergenic
916391420 1:164334799-164334821 TCTCTCATACAGAAGGTACTTGG + Intergenic
923721527 1:236471046-236471068 TCTCACATACAAAAGGACCCAGG - Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924209320 1:241748433-241748455 TCTCACATGACAAAGGGGCAAGG + Intronic
1063189741 10:3682183-3682205 TTTCATTTGCAGAAGGGGCAGGG + Intergenic
1063567925 10:7188540-7188562 TGTCACAAAGAGAAGTGGCAAGG + Intronic
1064325673 10:14349181-14349203 TCTCCCATACAGAATAGCCATGG - Intronic
1064851388 10:19712781-19712803 TATCACATTCATAAGGGGAAAGG + Intronic
1067379733 10:45761839-45761861 TGTAACATGCAGGAGGGGCACGG + Intronic
1068296867 10:55081634-55081656 ACTCACATAGCGAAAGGGCAAGG - Intronic
1069949424 10:72008808-72008830 TTTAACAATCAGAAGGGGCAAGG + Exonic
1071035833 10:81244102-81244124 TCTCACATGCAGAAAGGTCAAGG - Intergenic
1071372765 10:84969282-84969304 TCTCACATACAGAAATGCAAAGG - Intergenic
1074894308 10:117761830-117761852 GCTCACATTCAGAAGGGACCTGG - Intergenic
1077995203 11:7446802-7446824 GCTCACAGACAGAAAGGGCAGGG - Intronic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1080441307 11:32297266-32297288 TCTCCCAAATAGATGGGGCATGG - Intergenic
1081147509 11:39581207-39581229 TATCACAAACAGAATGTGCAAGG - Intergenic
1083122330 11:60526708-60526730 TCTCACATAAGCAAGGGGCTTGG + Intronic
1083376200 11:62223944-62223966 TCTCAAATAAGGAAGGGGGAAGG - Intergenic
1084459897 11:69290902-69290924 GCTCACAGGCAGAAGGGTCAGGG + Intergenic
1084761414 11:71273993-71274015 TCCCAAATAAGGAAGGGGCATGG + Intergenic
1085704211 11:78771348-78771370 TCGCACAGTCAGAAGCGGCAGGG + Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1089200104 11:116719509-116719531 TCTAAGATCCACAAGGGGCAGGG + Intergenic
1092076058 12:5674507-5674529 TCTCACATACAGAAAGTGGCTGG + Intronic
1099543929 12:83951509-83951531 TCCCACTTACAAAAGGGCCAGGG + Intergenic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1106609353 13:31263729-31263751 TCTCACAAACACAATGGGGAAGG - Intronic
1106650116 13:31681506-31681528 TCTCACATAAAGTTGGGTCAGGG + Intergenic
1110816337 13:79864459-79864481 TGACACATACAGAAGAGGCCTGG - Intergenic
1112768396 13:102771522-102771544 TCACACACACAGATGGGGAAAGG - Intronic
1113510064 13:110846658-110846680 TCAGACAGACAGCAGGGGCAGGG + Intergenic
1117705196 14:58458973-58458995 TCTCACAACCACAATGGGCATGG + Intronic
1119287571 14:73467881-73467903 TCTCACATACAGAACAGCTAAGG + Intergenic
1121218019 14:92263758-92263780 TCTCCCATCCAGAGGGGGCTAGG + Intergenic
1122097710 14:99383595-99383617 GCTCACAAAGAGACGGGGCAGGG - Intergenic
1123159126 14:106260418-106260440 TCACACCTGCAGGAGGGGCAGGG + Intergenic
1123207871 14:106730794-106730816 TCACACCTGCAGGAGGGGCAGGG + Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123917757 15:25049360-25049382 TTTCACATGCAGGATGGGCATGG - Intergenic
1124842612 15:33257669-33257691 TGTCACATGCGGAAGAGGCAAGG + Intergenic
1125597326 15:40895193-40895215 TCCCACCTCCAGAAGGGGCCTGG - Intronic
1125789886 15:42356988-42357010 TATCAAACACAGAAAGGGCAAGG - Intergenic
1127764152 15:62168352-62168374 TCTCACATACAGTAAAAGCAGGG + Intergenic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1135639414 16:24108052-24108074 TCTCCCATTAAAAAGGGGCAGGG + Intronic
1139717084 16:68822350-68822372 CCTCAAAGACAGAAGGGACAAGG - Intronic
1142878845 17:2869018-2869040 TCTCACATAGCGAAGGGGCAAGG + Intronic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143652998 17:8275856-8275878 TCTTACATACAGCAGGTGCTGGG - Intergenic
1145326932 17:21840024-21840046 TCGCACAGACAAAAGAGGCAAGG + Intergenic
1146249306 17:31324355-31324377 TCACACATACAGGCAGGGCATGG - Intronic
1148762015 17:50009541-50009563 TCCCAGATAGAGAAGAGGCATGG - Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1152747849 17:82049488-82049510 CCTCACGTACAGATGGGGTATGG - Intronic
1153016764 18:589720-589742 TCTAACATGCAGAAAGGGAAAGG - Intergenic
1155703624 18:28780475-28780497 TCTGACATACAGATATGGCAAGG + Intergenic
1157822574 18:50784496-50784518 ACACACACACAGAAGGGGCATGG + Intergenic
1159568400 18:70083127-70083149 TCTCATATCCAGCAGGGGCCTGG + Intronic
1160609848 18:80076500-80076522 TTTCACCGACAGCAGGGGCAGGG - Intronic
1161005187 19:1932116-1932138 TTTGAAACACAGAAGGGGCAAGG + Intergenic
1162090206 19:8274658-8274680 TCTCAAAAAAAGAAGGGGCTGGG - Intronic
1162125996 19:8499812-8499834 TCAAACACACAGAAGGGGCATGG + Intronic
1163057169 19:14728966-14728988 TCTCAAATAAAGAAGGGGGAAGG + Intronic
1164717355 19:30403050-30403072 TTTCACATACAGAAGGGATGGGG + Intronic
1166315865 19:41989228-41989250 TGTCACATAGAGGTGGGGCACGG - Intronic
1166752499 19:45171004-45171026 TCTTAAAAACAGAAGGGGCTGGG + Intronic
1166859921 19:45804208-45804230 TCTCACAAACGGCAGGAGCAGGG - Intronic
1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG + Intronic
1168397783 19:56063735-56063757 TCTAACATAAAGACAGGGCAAGG + Intergenic
925498725 2:4481116-4481138 TCCCAAATAAGGAAGGGGCAAGG + Intergenic
926827609 2:16922935-16922957 ACACACATACAGAATGAGCAGGG - Intergenic
927852172 2:26506328-26506350 TCACACATGCGGAAGGGCCAAGG - Intronic
937097318 2:119243824-119243846 ACTGACATAAAGATGGGGCAGGG - Intronic
939410866 2:141823126-141823148 TCTCTCTTACAGATAGGGCATGG + Intronic
940483736 2:154271028-154271050 ACTCACATACACAAGATGCAGGG + Intronic
940894153 2:159064342-159064364 TTTTACATACTGAAGGGGCATGG - Intronic
942164154 2:173225296-173225318 TCTTCCATCCAAAAGGGGCAGGG + Intronic
942326147 2:174778670-174778692 TCACATTTACAGAAGGGTCATGG + Intergenic
943880585 2:193139902-193139924 GCTCACAGGCAGAAGGGGCTTGG - Intergenic
947313101 2:228825668-228825690 TCTCACATAGAATAGGGACATGG + Intergenic
947489276 2:230579825-230579847 TAGCACACACAGAAGGGGGAAGG - Intergenic
948540718 2:238689978-238690000 TCCCAAATACAGAAGGCTCATGG - Intergenic
948722298 2:239908751-239908773 TCTCAGTTAGAGAAGGGGCCAGG + Intronic
1168815718 20:735349-735371 TCCCAGAACCAGAAGGGGCAAGG + Intergenic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1173030854 20:39358320-39358342 TCTTACATGCAGAAGGGCCTGGG + Intergenic
1174064328 20:47853654-47853676 TCTCAGACACAGGAGGGGCTGGG + Intergenic
1174416887 20:50373335-50373357 TGTCACAGAGAGAAGGGGCGAGG + Intergenic
1174794505 20:53510905-53510927 TCCCACATGCACTAGGGGCAGGG + Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178117862 21:29436073-29436095 ACTCACATAGAGAAGAGACAGGG + Intronic
1178121388 21:29473719-29473741 GCTCACAGACAGAGGGAGCAGGG - Intronic
1179027822 21:37694354-37694376 GTTCAAATAGAGAAGGGGCATGG + Intronic
1179174125 21:38995171-38995193 CCTCACATACAAAAGGTGCTTGG - Intergenic
1180197035 21:46203123-46203145 TCAGACAGCCAGAAGGGGCAGGG + Intronic
1181442362 22:22943245-22943267 TGTCACATACACAGGGTGCACGG + Intergenic
1182160559 22:28116913-28116935 ACTCACAGGCAGAAGAGGCAGGG - Intronic
1182354075 22:29714339-29714361 TCACGCATAGGGAAGGGGCAGGG + Intergenic
1182626178 22:31648203-31648225 TGTCACCAACAGAATGGGCAGGG + Intronic
1183054504 22:35295402-35295424 CCACAGATACAGAAGAGGCATGG - Exonic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184950988 22:47842488-47842510 AGTCTCATGCAGAAGGGGCAGGG - Intergenic
949619662 3:5796305-5796327 TTTCACATACATAATTGGCAGGG - Intergenic
949832729 3:8233216-8233238 TCTGAAATACAAAATGGGCATGG - Intergenic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
950659272 3:14456761-14456783 ACTCCCATGCAGGAGGGGCAGGG - Intronic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
954594707 3:51814506-51814528 TCCAACACACAGAAGGGGCTTGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954807878 3:53230816-53230838 TTTCACAGCCAGAAGGGGCCGGG - Intronic
956639827 3:71405114-71405136 TCTCCCAAAGACAAGGGGCAAGG + Intronic
957290335 3:78270452-78270474 TCTCACATACAGGAGGGGTGAGG - Intergenic
958038880 3:88202565-88202587 TCTAACATAGAGACTGGGCATGG + Intergenic
958898115 3:99853065-99853087 TCTCAGATAGGGATGGGGCATGG - Intronic
962712585 3:138100310-138100332 TGTCACACTCAGAAAGGGCAGGG + Intronic
963003012 3:140700812-140700834 TCTGACATGCAGAAGGGCCCAGG + Intronic
963119622 3:141765009-141765031 GATCACAGACAGAAGGGGCAAGG - Intergenic
964063223 3:152551196-152551218 ACACACACACACAAGGGGCAGGG + Intergenic
965005561 3:163018829-163018851 TCTCCAACTCAGAAGGGGCAGGG - Intergenic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969593582 4:8135517-8135539 CCTCACACTCAGAAGGGGCGAGG - Intronic
973793410 4:54399098-54399120 TCCCACATACAGAACTGGGAAGG - Intergenic
974468814 4:62292778-62292800 TCTCCCATGCAGAGGAGGCAGGG - Intergenic
975639934 4:76490359-76490381 TCTGACATGCAGAAAAGGCAGGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977005360 4:91562027-91562049 TCTCATATACATAAGGGAAATGG + Intronic
980432029 4:132713744-132713766 TCTCACATACTAATGGGGAAAGG - Intergenic
981310919 4:143297411-143297433 GCCCACAGACAGAAGGGCCAGGG - Intergenic
985781274 5:1873152-1873174 TCGCAAAGACAGAAGGAGCAAGG + Intergenic
991776640 5:70091658-70091680 GCTGACACACTGAAGGGGCAAGG + Intergenic
991855927 5:70967105-70967127 GCTGACACACTGAAGGGGCAAGG + Intergenic
991869942 5:71099878-71099900 GCTGACACACTGAAGGGGCAAGG + Intergenic
992156563 5:73960629-73960651 TCTCACATGCAACAGAGGCAAGG - Intergenic
992349960 5:75918581-75918603 TCTCACACACACAAGCGGCATGG - Intergenic
993363110 5:87002379-87002401 CCTGAAATACAGTAGGGGCATGG - Intergenic
994394894 5:99219473-99219495 TCTAATATCCAGAAGGGGAAAGG - Intergenic
997205357 5:132045183-132045205 TCCCACATAGTGAAGGGGAATGG + Intergenic
998068287 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG + Intronic
998528639 5:142864927-142864949 TATCACACACACACGGGGCAAGG - Intronic
998886667 5:146701689-146701711 TCACAAAAAAAGAAGGGGCACGG - Intronic
999973202 5:156885348-156885370 TCACACAAACAAAAGGGTCAAGG + Intergenic
1000925885 5:167193483-167193505 TGTAACAGACAGAAAGGGCAGGG + Intergenic
1001749870 5:174120703-174120725 TCTCAGATACATAAGTGGAAAGG + Intronic
1003447042 6:6194231-6194253 CCTCACTTACAGGAGGGACAAGG + Intronic
1003532148 6:6946664-6946686 TCTCTCAGACTGAAGGGGGAGGG - Intergenic
1005474570 6:26195671-26195693 ACTCACATACCGGAGGGGCCTGG - Intergenic
1006440070 6:34048435-34048457 TCTCCCACACAGGAGGGGCTGGG + Intronic
1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG + Intronic
1008208060 6:48687072-48687094 TCCCACTGCCAGAAGGGGCAGGG - Intergenic
1014066675 6:117135038-117135060 TCTCACATTATGATGGGGCAGGG - Intergenic
1017600644 6:156077101-156077123 GCTCGCAGACAGAAGGAGCAGGG + Intergenic
1019224714 6:170500401-170500423 TTTCAGAAACAGCAGGGGCAGGG - Intergenic
1019705292 7:2494547-2494569 GCTCACATCCAGAGGGGGAAGGG + Intergenic
1021668559 7:23013244-23013266 ACTCATAGAAAGAAGGGGCAAGG + Intronic
1022782802 7:33602876-33602898 TCCCACATACAGAGACGGCAAGG - Intronic
1023297986 7:38736546-38736568 AGTCACATACAGAATTGGCATGG - Intronic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1026562850 7:71464630-71464652 TTTGACAAACAGAAAGGGCACGG + Intronic
1032430997 7:131861492-131861514 TCACATAGACAGAAGGGGAAAGG - Intergenic
1034233246 7:149548873-149548895 TCATAAACACAGAAGGGGCAGGG - Intergenic
1036019800 8:4831851-4831873 TGCCACATCCAGAAGGTGCAAGG + Intronic
1039615596 8:38952508-38952530 TCCCACATTCAGCAGGGGCAAGG - Intronic
1042938757 8:74086801-74086823 TCTCACATGGGGAAGGAGCAAGG - Intergenic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1044650538 8:94489850-94489872 TATCATATACAGAGGGGGCTAGG - Intronic
1045176724 8:99732987-99733009 TCTCACATTTAAAAGGGGGAGGG + Intronic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1051118800 9:13729149-13729171 TCTCACATGCACAAGGGGAGAGG - Intergenic
1056072517 9:83003226-83003248 ACACACACCCAGAAGGGGCATGG + Intronic
1057847697 9:98538321-98538343 TCTTTCATCCAGAGGGGGCATGG + Intronic
1058829070 9:108799239-108799261 TCTCACACATAGTAGGGCCATGG - Intergenic
1061980612 9:134101313-134101335 TCCCAAATAAGGAAGGGGCATGG + Intergenic
1062022981 9:134327758-134327780 CCTCACATCCAGGAGGGGCTAGG - Intronic
1062046120 9:134425350-134425372 TCTGACAAACACAAGGGTCAGGG - Intronic
1062290610 9:135792699-135792721 TCTAACTTCCAGAAGGGGCTTGG - Exonic
1062417906 9:136462588-136462610 TGGCACACACAGCAGGGGCACGG + Intronic
1185445076 X:253630-253652 ACTCACATCCAGGAGGGTCACGG + Intergenic
1185586611 X:1245949-1245971 TCTAAGAGACAGAAGGGGCCGGG + Intergenic
1189620802 X:42835223-42835245 ACTCACATAGAGAAAGGGAAGGG + Intergenic
1189982211 X:46522143-46522165 TCTGACAAGCAGAAGTGGCACGG + Intronic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1191754444 X:64579326-64579348 TCACACAGACAGAAGTGACAGGG - Intergenic
1198107957 X:133478945-133478967 TCCCACTTACAGAAAGAGCAAGG + Intergenic
1198756495 X:139987775-139987797 TCTCACATACAGAAATGCAAAGG + Intergenic
1199579316 X:149345523-149345545 CCGTACACACAGAAGGGGCATGG - Intergenic