ID: 1100404370

View in Genome Browser
Species Human (GRCh38)
Location 12:94260603-94260625
Sequence CTGGGTGAACCATTGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100404370_1100404372 -6 Left 1100404370 12:94260603-94260625 CCTGCAGCCAATGGTTCACCCAG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1100404372 12:94260620-94260642 ACCCAGCTCTCTTTTTCAACAGG 0: 1
1: 0
2: 1
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100404370 Original CRISPR CTGGGTGAACCATTGGCTGC AGG (reversed) Intronic
900101760 1:964928-964950 CGGGGTGAGCCCCTGGCTGCAGG - Intronic
900534381 1:3169776-3169798 CGGGGGGAACCAGGGGCTGCGGG - Intronic
901206944 1:7502918-7502940 CAGGGTGAGCCATGGGGTGCGGG - Intronic
901314249 1:8295095-8295117 CTGGGTAGACCATGGGCTCCTGG - Intergenic
902186883 1:14732097-14732119 CTGGGTGAACTACTGGCTCAAGG + Intronic
913535316 1:119766651-119766673 CTGGCTTAACCATTAGCTCCCGG - Intronic
915001458 1:152597634-152597656 CTGGGTGAAAGCTTGGCAGCTGG + Intronic
915090288 1:153419457-153419479 CTGGGTGACCCACTGGATGGGGG - Exonic
915095205 1:153457634-153457656 CTGGGTGACCCACTGGATGGGGG + Intergenic
917214655 1:172665514-172665536 CTGGGTGAAACATTTGTTGAAGG + Intronic
919225140 1:194688222-194688244 CTAAGTGTAACATTGGCTGCAGG - Intergenic
919743465 1:200994275-200994297 CTGGGAGACCCCGTGGCTGCAGG + Intronic
920364026 1:205438680-205438702 CTGGGTGAAGAAGGGGCTGCCGG + Intronic
1063754770 10:8995159-8995181 CTGGGTGAACTGGTGGCTGAGGG - Intergenic
1065990093 10:31000606-31000628 CTGGGTGAACAGTGGGCTACAGG - Intronic
1066378988 10:34885410-34885432 CTCCCTGAAGCATTGGCTGCAGG - Intergenic
1077856418 11:6130739-6130761 AAGGGTGAAATATTGGCTGCAGG + Intergenic
1087094262 11:94305151-94305173 CTGGGGGAGCCATGGGCTCCTGG + Intergenic
1088077712 11:105872381-105872403 CTGTGTGAGCCATTGGCTCTGGG - Intronic
1089977742 11:122747050-122747072 CTGGCTGAAGCAGAGGCTGCGGG + Intronic
1090240030 11:125175294-125175316 CACGGAGCACCATTGGCTGCTGG + Intronic
1094220345 12:27986232-27986254 CTGGGTGAAAGATGGGCTTCAGG - Intergenic
1099442036 12:82710694-82710716 ATGGGTGAATCATTGACTACTGG + Intronic
1099878023 12:88433290-88433312 CTGAGTGGACTTTTGGCTGCCGG + Intergenic
1100404370 12:94260603-94260625 CTGGGTGAACCATTGGCTGCAGG - Intronic
1101069808 12:101062479-101062501 CTGGGGGAAGCAGTGGCTGTCGG - Intronic
1109931765 13:69225522-69225544 CTGGCAGAAGCATTGCCTGCAGG - Intergenic
1110340936 13:74389024-74389046 TGGGGTGAATCCTTGGCTGCCGG - Intergenic
1112792435 13:103017413-103017435 CCAGCTGAACCAATGGCTGCGGG + Intergenic
1114220145 14:20689128-20689150 CTGGGGGAGCCATTTGCTGAAGG + Intronic
1114262745 14:21050296-21050318 CTGGCCGTGCCATTGGCTGCTGG + Intronic
1121067941 14:90986760-90986782 CTGTGTTAGTCATTGGCTGCAGG - Intronic
1121248341 14:92481014-92481036 CTGGGAGAACGATTGGATCCAGG - Intronic
1122385409 14:101341939-101341961 CTGGGTACAGCAATGGCTGCAGG + Intergenic
1124720469 15:32107275-32107297 CTGGGTACACCATTTGCAGCTGG - Intronic
1124918714 15:34002407-34002429 CTGGGTGTACAGATGGCTGCAGG - Intronic
1128766602 15:70254869-70254891 CTGGGTGAACGACTGACTGATGG - Intergenic
1129793977 15:78362133-78362155 CTGGGTGAGCCTTCGGCTGACGG + Intergenic
1132603023 16:782295-782317 CTAGGGGACCCATGGGCTGCTGG + Intronic
1135188609 16:20336181-20336203 CTGGGTGATCCATTAAGTGCAGG - Intronic
1136233871 16:28903066-28903088 CTGGGTGAACATCTGGCTGCTGG + Exonic
1137567885 16:49544870-49544892 CAGGGTGCAGCATTGGGTGCTGG + Intronic
1137713841 16:50585601-50585623 CTGGGTAAACGCTTGGCGGCTGG - Intronic
1138415614 16:56869897-56869919 CTGGGTGTACCATTGGGTTGGGG - Intronic
1141368112 16:83462983-83463005 CTGGGTTTACCATTGTCTGTTGG - Intronic
1141685264 16:85566461-85566483 CTGGGTGAACCCTGGGCCCCAGG + Intergenic
1141722227 16:85762889-85762911 ATGGGTGAACCAGAGGCTGCAGG + Intergenic
1142064991 16:88057235-88057257 CTGGGTGAGCTCTTGGCGGCTGG - Intronic
1143023731 17:3929387-3929409 CTGGATGAACCCCTGGCTGCTGG - Exonic
1144074560 17:11704979-11705001 GTGGGTGAATCATAGGCAGCAGG - Intronic
1144884322 17:18448453-18448475 GTGGGGGAACCATTCTCTGCAGG + Intergenic
1145147909 17:20495924-20495946 GTGGGGGAACCATTCTCTGCAGG - Intergenic
1148378064 17:47168149-47168171 CTGATTAAACCATTGGCTGTTGG + Intronic
1149996619 17:61409260-61409282 CTGGGGGGGCCCTTGGCTGCGGG + Exonic
1152205066 17:78970223-78970245 CTGGGGGACCCATTGGATGCCGG - Intergenic
1158137146 18:54220603-54220625 CTGTGTGAACAATTGGGTGCAGG + Intronic
1158569688 18:58587139-58587161 CTGGGAGACCCATTGGTTCCAGG + Intronic
1159995097 18:74956721-74956743 CTGGGAGAAGGATGGGCTGCTGG + Intronic
1160281682 18:77496647-77496669 CCTAGTGAACCATTGGCTGAGGG + Intergenic
1162771921 19:12954215-12954237 CTGGGTGCCCCAGAGGCTGCTGG + Exonic
925436738 2:3844796-3844818 CTGGGTGAATCATTGCCCGCTGG + Intronic
926501080 2:13653118-13653140 CTAGGTGAGTCATTGGCAGCAGG - Intergenic
931229407 2:60361501-60361523 CTGGGTGAACCCTGGGCTGTAGG - Intergenic
933716129 2:85362183-85362205 CAGGGTGAAAGATTGTCTGCTGG + Exonic
942835481 2:180291631-180291653 CTGGGTGATTTGTTGGCTGCAGG + Intergenic
946157608 2:217817562-217817584 CTGGGTGAATCACTGACTTCTGG - Intronic
946433041 2:219635650-219635672 CTGGGGGAACAAGGGGCTGCTGG - Intronic
947841158 2:233208718-233208740 CTGGGGAACCCACTGGCTGCTGG + Intergenic
948100058 2:235366177-235366199 CTGGGTGAATTAGTGGCTGATGG - Intergenic
948757219 2:240166762-240166784 CTGGGTGGCCCAGTGGCTGGCGG + Intergenic
1168909857 20:1439051-1439073 CTGGGTGAACCACCTGCAGCAGG - Intergenic
1170121372 20:12916312-12916334 CTGTGTGGTCCATTGGCTGTAGG + Intergenic
1171216163 20:23353974-23353996 CTTGGGGAACCAGGGGCTGCAGG - Exonic
1172904671 20:38360175-38360197 CTGGGTGAACCTCTGCCTCCTGG - Intronic
1173733891 20:45346400-45346422 CTGGGTGACCCATCAGCTGCAGG - Intronic
1174335052 20:49853968-49853990 ATGGGTGATCTTTTGGCTGCAGG - Intronic
1175040671 20:56047337-56047359 CTGTGTGAACTTTTGGCTGGAGG - Intergenic
1175298631 20:57927233-57927255 CTGGGTGAACCATAAACTACTGG - Intergenic
1176301853 21:5102327-5102349 CGGGCTGTACCGTTGGCTGCTGG - Intergenic
1176913820 21:14600744-14600766 CTAAGTGAAGCATTGTCTGCTGG - Intronic
1178581059 21:33839125-33839147 TTGGGTGCCCCATTGGCTTCTGG + Intronic
1178622875 21:34191961-34191983 TTGGGTGTCCCATTGGCTGTGGG + Intergenic
1179855178 21:44159573-44159595 CGGGCTGTACCGTTGGCTGCTGG + Intergenic
1180612122 22:17104841-17104863 CTGGGAGAACAAGTGGCTGAAGG + Intronic
1181484724 22:23223576-23223598 CTGGCTGAGCCCTAGGCTGCCGG + Intronic
1181941482 22:26480990-26481012 CTGGATGTACAACTGGCTGCAGG + Intronic
1182086153 22:27562621-27562643 CTGAGTGAGCCATTGCATGCAGG - Intergenic
1182330652 22:29549456-29549478 CTGGGTGAACACTTGAATGCAGG - Intronic
1183398896 22:37589423-37589445 CTGGGGAGACCATGGGCTGCAGG + Intergenic
952262337 3:31752693-31752715 CTGGGTAAAGCAAGGGCTGCGGG + Intronic
953179807 3:40584658-40584680 CTGGCTGAGCCATTGGCCCCCGG + Intergenic
960844791 3:121995446-121995468 CTGGATGACCCCTTTGCTGCTGG - Intronic
962212523 3:133491129-133491151 CCGGCTGAACCCATGGCTGCGGG - Intergenic
962305006 3:134278206-134278228 CTGAGAGCACCATGGGCTGCAGG + Intergenic
965578633 3:170244326-170244348 CTGATTAAACCACTGGCTGCTGG - Intronic
968005611 3:195240648-195240670 ATGGGTGAACCCTTGGCCTCCGG - Intronic
969443627 4:7232171-7232193 CTGGGGGAAGCATGGGCTGTGGG + Intronic
969672820 4:8598980-8599002 CTGGGTGCAGCAGTGCCTGCTGG + Intronic
975739433 4:77414803-77414825 CTGGGGGAAGCATAGGTTGCTGG + Intronic
976887830 4:90007746-90007768 CTGGGTGAGGCCATGGCTGCTGG + Intergenic
979918569 4:126470899-126470921 GTGGGTGAACCATTTGATCCAGG + Intergenic
982596004 4:157384006-157384028 CTGGGTAAGCCATTGGCACCTGG + Intergenic
982680172 4:158419177-158419199 CTGGGTGAGCCTGTGACTGCCGG - Intronic
985405514 4:189634206-189634228 CTGGGTGACCCATTTGTGGCTGG + Intergenic
988047994 5:25984407-25984429 CTTGGTCAGCCATTGGCTGGGGG - Intergenic
989001248 5:36762892-36762914 ATTGGCCAACCATTGGCTGCAGG + Intergenic
990791224 5:59482312-59482334 CTGGTTTAACCATTGTCTACTGG + Intronic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
1000288257 5:159846473-159846495 CCAGATGAACCATGGGCTGCAGG + Intergenic
1002600232 5:180350213-180350235 CTGGGTGACCCCTTGGGTGATGG - Intronic
1002643786 5:180643228-180643250 CTTGGTGACCGATTGGCTGTGGG - Intronic
1002913512 6:1509859-1509881 CAGGGTGAACCCTAGGATGCTGG - Intergenic
1003332808 6:5143824-5143846 CTTTGTGAGCCACTGGCTGCCGG + Intronic
1003958147 6:11185227-11185249 CTTGGTGCACCATTTCCTGCAGG + Exonic
1007450101 6:41935979-41936001 CTGGCTGGGCCCTTGGCTGCTGG + Exonic
1007597924 6:43062997-43063019 CCAGGAGAACCAGTGGCTGCGGG + Exonic
1012046628 6:94283800-94283822 CTGGGTGATCCATAGGAAGCAGG - Intergenic
1013643120 6:112107547-112107569 CTGTGTGTGCCATTTGCTGCAGG + Intergenic
1021340258 7:19455857-19455879 CTGGGTGAGCCTGTGGCTACCGG - Intergenic
1022360100 7:29649436-29649458 CTGCGTGCACCAGGGGCTGCAGG + Intergenic
1023024047 7:36035265-36035287 CTGGGTGAGCCAATTCCTGCTGG - Intergenic
1024950468 7:54855620-54855642 CTGGGGGAAGCAGTGGCTGTGGG - Intergenic
1027908552 7:84217145-84217167 CTGCGTTAACCATTGGTTTCAGG - Intronic
1035172160 7:157022799-157022821 CAGGGTGGACCAGGGGCTGCTGG - Intergenic
1036993658 8:13629810-13629832 CTGGGTGACCCATTGGAGGAAGG + Intergenic
1039512933 8:38105841-38105863 CAGGGCGAGCCATTGGCGGCGGG - Intronic
1041483464 8:58348693-58348715 CTAGGTGAGCCATGGGATGCAGG + Intergenic
1043325819 8:79049780-79049802 GAGGGTGAACCATTGGTTTCAGG - Intergenic
1048553373 8:135454517-135454539 CTGGCTGAGCCGTTGGCTGTGGG - Intergenic
1048977217 8:139679877-139679899 CTGAGGGAAGCATGGGCTGCAGG - Intronic
1049602502 8:143514390-143514412 CTGGGTGGGCCAATGGCTCCAGG - Intronic
1056117894 9:83459419-83459441 CTGGGTGGACCATTGTGTGGAGG + Intronic
1061343689 9:130004419-130004441 CTGGGTGAATAATTCACTGCAGG - Intronic
1062031780 9:134365109-134365131 CGGGGTGAGCCAATGGCTCCGGG + Intronic
1189588112 X:42482051-42482073 TTGGGTGAACAATTAGCTGGAGG - Intergenic
1189904826 X:45747124-45747146 CTGGGTGATCCTTTGCCTTCTGG + Intergenic
1197170692 X:123430536-123430558 CTTGGAGACCAATTGGCTGCCGG - Intronic
1199975531 X:152893095-152893117 CTGGCTAAACCACTGGCTGAGGG - Intergenic